Life is so Beautiful - the Research of Our Beautiful World

Grandpa Shuffling

2012-02-16T03:37:00.000+08:00

Watching this grandpa dance does create some joy somehow.

The Most Intense Taekwondo Fight Ever

2012-02-01T21:49:00.000+08:00

Cute boys! When are they going to reach each other?

Kindness go around

2012-01-28T03:33:00.000+08:00

Offer a little kindness for others and you may get a good reward one day.Comments from Youtube Users:@koonal127, thumbs up for the wonderful videoWanloqz 4 minutes agoNice.. Peace No WarWanloqz 5 minutes agoResource based ecnomyTheMidwestsk8ter 9 minutes agoSomeone pleeease thumbs down that fagget at the top^TheMidwestsk8ter 14 minutes ago@TheMidwestsk8ter donepoppazach 7 minutes agoa little bit exaggaratedoritze 18 minutes agoGood....like itabhimanyukvpandey 18 minutes agopaying it forward :)honeyyzmilkk 29 minutes agokindness leaves the homeless homeless, but now we can smile at him.....martijnmta 38 minutes ago in playlist WachtrijSharing is like a boomerang. The more you send it out the more it come back. Loved that clip put a huge smile on my face.Jammin2vibes 40 minutes agothe world my daddy, rest his soul, taught me, was this world, It's just good mannersSherrilos 43 minutes ago3:08 'I don't need his stinky hotdog. Here you can eat it! Probably will give you a stomach ache'.Bugstomper2 43 minutes agocan i know what song used in this video?theferociousfox 44 minutes agoall it takes is for ONE person to pay it forwardCarolAdamson1 45 minutes agoAmazing video!suliquinhas 1 hour agoKid forgot his skateboard!qoothecat 1 hour agoi'm sorry for ruining it, but the kid totally forgot his skateboard and papers he dropped to help that lady... poor kid... that's gonna suckgreengreyandblue 1 hour agoNice Rx At 4:48juanpenca1 1 hour agoPay It Forward =)MystExia 1 hour agoIts ....... MATISYAHU - One Dayjijufernandez 1 hour agoMy heart just explodeddog2547 1 hour agowhat a nice & dreamy concept. am i definately sharing this? no... this is played out. i understand yeah do a little nice thing and that person will do another little nice thing and so on. that would be cool if reality were really like that, i supposecasspoon17 1 hour ago@casspoon17 ..it is a good concept -it is a great plan of action. being nice only helps...may cause a little suspicion at first but really helps people to not be so jaded about life. make it a reality - don't share the video - share the love <3MissBehavin1111 1 minute agolet me help you click the like button...tanpabukti 1 hour ago 10Oh....So that's where all the kindness in the world went! WatchedProductions 1 hour agoso beautiful .. where is this? wat's the song MGSP 1 hour ago; } God Bless All Of You Tubers & Future Tubers : } dnnylee 1 hour agowell, 25 people don't know how to help others :Dlelouchxenryo 1 hour agoI'm strongly reminded of a story in a book of short stories written by Enid Blyton about a good deed a day or something along the line. Has anyone ever read it? Please correct me if I'm wrong. :)jcroxx 1 hour agopraise God, he is good and love conquers all!!hakunamakarla 1 hour agoDo Something positive today...Tanarus20 1 hour agoThis is nice to watch, but it would ultimately be stupid to believe or even hope to believe the world will ever be like this. People are out for themselves nowadays and the majority are cunts. I can say that as i can admit myself im no different!BD0TT 1 hour agowho know this song name?yeeegeren 1 hour ago@yeeegeren One Day - matisyahu :>TheMrSuPeRmAn24 1 hour agoSounds like SgtMullet needs to move!Kennyjsk8s 1 hour agoBeautiful cyclegohxinyan 1 hour agowowMGSP 1 hour agothe smile on the homeless person got me ='(MrSpurSy 1 hour agoPass it Foward. Beautiful.woodtickrae 1 hour agoI got goosebumps... my kind of BLESSING!mexycan2000 1 hour agosuch a beautiful thing to believe in :')MsFigure09 1 hour agoThis has been flagged as spam showSgtMullet 1 hour ago 9This has been flagged as spam showTanarus20 1 hour ago@SgtMullet ummm.. that is the problem! thats the message in this video lol, if One of them was smart enough it all could change!GentleWhispering 1 hour ago in playlist Favorite videosExtremely touching how deeply a small thing can make such a huge change.GailChasin 1 hour agoWOW where is this city or town ? I want to live there where people treat other with RESPECT and OPEN HEARTS...oclouis1 1 hour agothe " PAY IT FORWARD ' In Action! :'DDarnoCurix 1 hour agoyes be good and nice to human.bergunjing 1 hour agoi think tht kid frgt his skateboard haha love this vidzarol95 1 hour agoI Love The Message! If only One Day this becomes reality!w314eva1 1 hour agoI saw this video ... i am keep smile start until to end i am cry...cutebaby0001 2 hours agothis reminds me of the movie "pay it forward" :)ChipandDale222 2 hours agowhy dont we start working on this shall we?whatalamenameaviotss 2 hours ago 4im dislike this video....all this is bullshit...not going happen in real life...keep in dreaming loser... TheDarkcrows 2 hours ago@TheDarkcrows It does happen, but it's got to start with you. if you don't give this then you won't see it. All your doing is telling us who you are by what you see in the world. Some day someone will come into your life and open your eyes to a far better world than you see right now.ThePowerWithinMe 2 hours ago in playlist Favorite videos@TheDarkcrows “Be the change you want to see in the world.” my friend, as Mahatma Gandhi said. Want to see this for real? Be the first to do it then.LuciSeichan 2 hours ago@TheDarkcrows A simple act of kindness can change somebody's life. Why should I deprive somebody of the chance to see that there ARE people that care?Indy1489 1 hour agoThis is beautiful. I only wonder why the government wasn't the one spreading all the happiness. Aren't they the ones who are responsible for making us happy?AynRandFanJG 2 hours ago@AynRandFanJG That's why in spite of our governments we can all rise above them and be the people they SHOULD BE. Don't wonder why... go do some good deeds.... maybe our governments will wake up one day and follow the people.ThePowerWithinMe 1 hour agoEveryone used to be like this, then they took an arrow in the kneeMrNiveus 2 hours agokindness, pass it onguitarhero2211 2 hours agoI cannot imagine why anyone would dislike this unless they are really, really sick.paradoxman316 2 hours agoThank you for sharing this video - wonderful and important! Keep doing what you do.Leahapalooza 2 hours ago22 people were in tears that they accidentally pressed the dislike button and couldn't undo it :)dopz1987 2 hours agojust 7 hours and the view pump from 300++ to 68396!propackping 2 hours agoinspiring hope its always happening everyday.beloy200 2 hours agoThe world of full humanity :)dealine1 2 hours ago天下太平。。。terrycby 2 hours agoFor a second I thought that kid was going to try to skateboard the groceries across the street LOL.greenspiraldragon 2 hours agoThis is wonderful! I guess out of 2,762 people who liked or disliked this, 22 dislikes isn't too bad of a ratio. Though its somewhat disheartening and hard to imagine what must be going on in the minds of those who actually hit the "dislike" button.Patrickmcmillan1 2 hours agoThere's still hope :)jcovpogikotalga 2 hours agoWonderful video!1968RIP 2 hours agoyeah, those who disliked this are definitely heartless.quiksilver0000 2 hours agofaith in humanity: restored.akmalbunny 2 hours ago 2What goes around comes around. :)ilamochi 2 hours agoOne dayTajikRecords 2 hours agoit will be sooo nice if our world now is such...=)lingeshan 2 hours ago22 people are heartless :(yovillegammer 2 hours agowhat a wonderful world in 500m radius...5447danny 2 hours ago 23Why is the woman feeding the meter? There is no parked car! Was she Wonder Woman and the car is invisible?OPMBvids 3 hours agoWhat comes around goes around :)MineDesBest 3 hours agosuperb! no words....naveen2411 3 hours agoWhat the world would look like if love was considered an intrinsic part of it...instead of a rare commodity... :/mdlittle5466 3 hours agoThis has been flagged as spam showahnoush 3 hours agoComment removedahnoush 3 hours agothe world wud be so beautiful if everyone does that.....ann345 3 hours agoSweet!!! =Dgengli1987 3 hours agoSTEALING THIS VIDEO WASN'T VERY KIND!MythLPriest 3 hours agoI like how they did this on one take..richarDISNEY 3 hours agoI wonder if the guy with the hat would be happy if the guy in the suit locked his car keys in the boot lolDarkMedievalTimes1 3 hours agoBeautiful video....Yolaine 3 hours agofast karma similar in pay it forwardjo3f3 3 hours agois this something like 'paying it forward' ?tkt3006 3 hours ago 2nice.........syazanarisan 3 hours agoI loved it.if we help someone then it's nt the waste.one day it comes to our door.MILAN364741 3 hours agoi like it,,,obuluy 3 hours agoVery nice video ;)Kazuya888 3 hours agolike it ...pawansingh300 3 hours agoI help out of kindness. Am trying my best to make this world like in this video. Let's be kind guys! WE CAN DO IT! =)Tmdkiller 3 hours agotoo bad this won't happen in real life.. not in my country anyway..sam86samss 3 hours ago@sam86samss Be the first.Yolaine 3 hours agoThis brought a smile on my faceSynergy1898 3 hours ago 2awesome......really worth sharing.saikumarmanchalaa 3 hours agoAwesome video that keep remind people of how kindness goes around the world!girlishyoo 3 hours agoCame here from facebook just to click the like button... This is the best in the world full of individualistic people, yea..?yelosadi 3 hours agocame here from facebook just to rate it. awesome work, guys!mickeyknoxBR 3 hours agoWe are all connected, help each other,its easy,it can only do good, The boy didnt forget his skateboard,the girls over the road if you look picked it up and meet him the otherside of the crossing. its in the eye of the beholder. love this video. peacevandewones 4 hours agoNice uh.TheYaohui 4 hours agoThe hell with the title. The title ruins everything.jeungyihklahp 4 hours agothis is the meaning of 'live'tyko14ma 4 hours agoB E A U T I F U L Lsexpolice101 4 hours agoOne good deed leads to another. silentcypher 4 hours agoBeautiful.killalmostwise 4 hours agoThe only video which nearly bring me down to tears and is literally the strongest video to dateTechnologeekable 4 hours agoGreat video..I hope you will share it :)swagattttt 4 hours agoThis is the lesson Haley Joel Osment taught us..... bcmcinnis 4 hours agoEveryone! The song is "One Day" by MatisyahuThumb this up so everyone can see!xSimpliiFy 4 hours ago 44@xSimpliiFy you can see it in the descriptionMythLPriest 3 hours ago@xSimpliiFyI tot it's Sean Kingston ^^luv the music and vid!KGKG05 1 hour ago18 people are heartless.Zeeqchris 4 hours ago 13@Zeeqchris NOPE, THEY JUST REALIZE THIS VIDEO WAS STOLENMythLPriest 3 hours ago@Zeeqchris Why not draw attention to the 2,780 people who aren't heartless, instead of the few that just haven't found love in their life yet? maybe by ignoring them they will be drawn to the light rather than them trying to draw us into the darkness.ThePowerWithinMe 2 hours ago in playlist Favorite videosHey all, this is a video of an ideal world isn't it? As many comments here go to show, we can't even be nice to each other on a thread, let alone a on a street? We don't have to go out of our way to make someone's day, just refraining from ruining it, is a challenge in our society today. But hope we can still try? I hope we all still try, try to let violence and hatred end with you. Don't pay that forward.szehunny 4 hours ago 2@szehunny This is the internet. what did you expect?Dracos1337 4 hours agoI was smiling throughout this entire video =),if only the world was like thisXvUchihaSasukevX 4 hours agoWhat is the song?trolltr0lltroll 4 hours ago@trolltr0lltroll ........... One Day - MatisyahuJuGgala22 4 hours agoBeautiful conceptarusselkm 4 hours agohey anyone know whats the title of the song use in this video?ijs13 4 hours ago@ijs13 One Day - MatisyahuJuGgala22 4 hours agoThis has been flagged as spam showsyahzamin 4 hours agoi love it...thenichloe 4 hours agoThe only think that kept me watching was the song.cmteh1 4 hours agoawesome! segiempattepat 4 hours ago2:50 two hot dogs without ketchup, mustard or anything....Draenokh 4 hours ago@lovekiki101 Oh I see.. I just have to say.. Try to think positive:)dragfire859 4 hours ago@dragfire859 Hey I can do that, I can think positive cuz I am an optimistic person but things like this derail my positive energy, lets all do our oart and stop racismlovekiki101 4 hours ago世界每一个人能做到,一定有个美满的天堂.tancheehin 4 hours ago 2Courtesy begets courtesy. Let it start from you.thedeadcockroach 4 hours ago 2@thedeadcockroach lmao why don't we start with you first hunlovekiki101 4 hours agoCoolZzRazorSharpzZ 4 hours agolol...I think everyone have a focus on the boy's skateboard as that is the starting point of the video.Lovely video, although the video sounds unreal. But it does broadcast it's message that we can pass our kindness around easily, sometimes with cash if you could afford. But most of the times, is from our hearts.But I don't really understand the lady in the restaurant session with the flowers...may be someone could enlighten me on this.goslmka 4 hours ago@goslmka the lady in the restaurant is lonely,,,maybe her husband or her son/daughter already gone.... you can look at the other girls at the restaurant..they were so happy with each other than the lady..so the girl bought bunch of flowers to make the lady feel appreciated!hannahceceliahc 2 hours agoLife is full of Karma.... be positive in everything you do and you'll get the benefit in the long run :))shaniz11 4 hours agoThis has been flagged as spam showmunkeynut 4 hours agoThis has been flagged as spam showmunkeynut 4 hours agoThis has been flagged as spam showmunkeynut 4 hours agoThis has been flagged as spam showmunkeynut 4 hours agoThis has been flagged as spam showmunkeynut 4 hours agoThis has been flagged as spam showmunkeynut 4 hours agoOh shiz. Awesome. :DLeGrandPradoRebutar 4 hours ago@lovekiki101 Fron the comment I see below.. I think that you are just being too sensitive of what people are saying about other racist. I can say that the rest of them have no intention to be racist. And I just think that you are being unreasonable for judging others the wrong way.dragfire859 4 hours ago@dragfire859 Ihave not judged anyone, all I said is the way that the African race is being portrayed is an unfavourable one. End of story, this is my view as I am African. Am I being sensitive? Maybe but I cannot help but feel like my race is being victimized in this scenariolovekiki101 4 hours agothe song name is 'Matisyahu ft Acon - One Day'Mrdaidera82 5 hours agoI Love it ... It dose happen xxxmijulesthc 5 hours agowhat goes around comes around...Sheginjo 5 hours agothe only thing i don't like about the video is how a black man is the homeless one and there isn't any other black examples... and it's like showing how kindness affects even a black man to not steal the cellphoneMixikyr 5 hours ago@Mixikyr Yes, yes and Yes finally someone gets what I'm saying. Please educate these ppllovekiki101 5 hours agoThis has been flagged as spam showmunkeynut 5 hours agolovekiki101 <--------ANTI-WHITE. Racist bitch, die of aids ya cuntmunkeynut 5 hours ago@munkeynut Typical response I would expect from an uneducate, illeterate, self absorbed rodent like yourself...but feel free to carry onlovekiki101 5 hours ago@lovekiki101 Haha, seems you have no friends. Whats up?? no job?? you spend all day trolling....you fail big time. Only racist here is you. You give negro's a bad name. Fucking retard go dig me some diamonds bitch.munkeynut 5 hours ago@munkeynut Hello and welcome to my blog. Im a 29 year old builder Im living in Nuneaton... Shakespeare's county of Warwickshire, England. Im single, looking forward to traveling the Trans-Mongolian railway. Please know that I have your informationlovekiki101 5 hours ago@lovekiki101 HAHAHAH, so you went to my blog LMFAO thats what its for!!! thanks for the payment, u really are dumbmunkeynut 5 hours ago@munkeynut Also you "ART" SUCKS, LMAOlovekiki101 5 hours ago@lovekiki101 Please keep viewing........each click is a payment!!munkeynut 4 hours ago@lovekiki101 Come on ya racist....keep viewing my blog, every page please. Share it too......pay me! LMFAO dumb fuckamunkeynut 4 hours agothis is stupid. why would someone help another with no strings attached in modern day society? More likely you'll get sued for poking your nose where it doesn't belong.Dracos1337 5 hours agolovekiki101 <,-- DIE OF AIDS U FUCKING SPEAR CHUCKA!munkeynut 5 hours agoThis has been flagged as spam showSmileMas 5 hours agonegro tramp got back to his stool and some fucker had stole his hot dog!munkeynut 5 hours ago@munkeynut Racist....lovekiki101 5 hours ago@lovekiki101 Dumb bastard how is that racist???????? the person is a negro. I fi had calle dhim a n*gger that would of been racist. U my friends are obviously have racist tendancies...or you would realise.munkeynut 5 hours ago@munkeynut You called him a negro tramp, I know you probably don't know this but africans are human as well. If you had typed the homeless guy or just refer to the situation everyone would know who you are referring to...but you had to bring his RACE into the equation...smhlovekiki101 5 hours ago@lovekiki101 Is he or is he not BLACK??????. thats nice racist u fucking retard. GET OVER YA'SEN.munkeynut 5 hours ago@munkeynut You do know that you can have a conversation without cursing or resorting to name calling right? Just informaing you...lovekiki101 5 hours ago@lovekiki101 Grammar is important too, thats how we understand 'helping you're uncle Jack off a horse and helping you're uncle Jack off an horse.munkeynut 5 hours ago@lovekiki101 You turned it into a race issue.....dumb bitch. The person is a negro, black. By calling me white, would that make u a racist too? i think not. Get a life u fucking retard.munkeynut 5 hours ago@munkeynut lol!Dracos1337 5 hours agoI can't believe to see the top comments. YES the boy forgot his skateboard! but really that's what you guys got from this video? some of you might think this is unreal. but THIS CAN ACTUALLY HAPPEN! If only you start to remember to give 1 simple kindness to other people EVERYDAY. it doesn't matter how big your contribution is. it is all counted! thats why the videos started from only the man who helped the boy get back up. let anyone know about this!jamezhalim 5 hours ago 55@jamezhalim nah, we kinda got the kindness thing inside already. we found the skateboard intriguing too.Azner2254 4 hours agosuprisingly..many Malaysian are sharing this on facebook...like if you are one of them!crestory 5 hours ago 40we will not be a poor by helping othersJihadYouth 5 hours agosounded like wavin flag by knaanradicalteh 5 hours agothis is ta'wun concept in IslamJihadYouth 5 hours agohe's being nice and giving his skateboard away, or maybe he's setting a booby trap either way its still funny.GoogIeMeNoob 5 hours agoi don't get why the girl would give a random lady a bunch of flowers.....r3i123 5 hours ago@r3i123 I think its because she looked lonely. maybe she doesn't have any family left. you can see she is an old lady and she was envious when looking the gathering from the other table. that's probably why she gave her the flowers.jamezhalim 5 hours agoPay it forward.. Trevor's utopia coming true. :)luckykid160194 5 hours agowe keep living the lie in front of our pc...the real world is out there and it;s gonna end real soonautosenamhden 5 hours agoComment removeddarkvicious23 5 hours agoComment removeddarkvicious23 5 hours agoThis has been flagged as spam showdarkvicious23 5 hours agoheart touching video .........!!MultiLegend80 5 hours agothis is one of the sweetest video i have seen.missfun24 5 hours agocan someone explain to me about the part where the girl in red, why did she bought the flower for that lady?c4un544n5 5 hours ago@c4un544n5 the old lad looked lonely. maybe she doesn't have any family left. esp seeing the lovely friends from the other table. thats probably why the girl gives those flowers :)jamezhalim 5 hours ago@c4un544n5 actually, i also didnt get the part. anyhow, the video is awesome.missfun24 5 hours agoits what the value it matters..131ll13 5 hours agoThat was wonderful, thank yousaltyfishlvr 5 hours agoSo why the BLACK MAN gotta be a homeless person?????? Racist much...lovekiki101 5 hours ago@lovekiki101 thats not racism, more like a stereotypeLycerate 5 hours ago@Lycerate At least you get my point, you got all theses WHITE ppl being something: vendor, waitress, granny making grocery. Then you get to the black and BOOM...Homeless person...Am like really.....lovekiki101 5 hours ago@lovekiki101 y do u have 2 judge a video in that aspect? anyhow, tat black guy was the sweetest one among all of them, he could have just steal or keep that thing with himself, but it is so nice of him to return it to the girl.missfun24 5 hours ago@missfun24 lol you are a mess. You see how you are sterotyping us, by stating that the homeless black man could also be a thief....You ppl kill me, racism will always be around once we have videos like these and ppl like you enforcing this type of scenarios and telling me a BLACK WOMAN that it's ok to portray my black men and good for nothing thieves....lovekiki101 5 hours ago@lovekiki101 omg, why r u thinking in such a way, dude. i didnt mean anthing in that way.missfun24 5 hours ago@missfun24 I tell it like I see it, years from now when someone sees this video what do you think they will see? The exact same thing that I saw. Why a white man couldn't be the homeless guy, out of all the things for an African to be portrayed as in this vid it has to be what society looks at as not being part of the society. Is this really how you feel about Africans aka black people. Listen my friend I am worth much more than a piece of bread and a bottled water...lovekiki101 5 hours ago@lovekiki101 no one isolate or tink of tat black guy in that perspective till u commented in such a way. so, who is discriminating the black fellow? mayb u should stop thinking in such a way. i have no comment already in this matter. it's up to u , how u want to think about the world outside there.missfun24 5 hours ago@missfun24 You simply cannot comrehend where I am coming from. As part of the African race we face more scrunity from the world of any other race. This is unfair. Until you put yourself in my shoe you would NEVER understand the way that Racial Victimization makes a persome feel.lovekiki101 5 hours agowhat the fuck . 17 dislikes ? are they human ?shinntss 5 hours agoi normally will not tease those who dislike a video, but for this one, please forgive me for being too mean, dont u all (the 17 people) feel that it enlightened u all to start doing good deed?FFBAK 5 hours agoOne Day!loudafool30 5 hours agoA lot of trouble for just 1 glass of water.. :DOne act of random kindness a day will make the world a better place to stay!4HahaTwo 6 hours agoBoy looks like Beiber! He be payin it forward!lyndonnorton1981 6 hours agoI remember the movie "Pay it Forward" .....wingondemand 6 hours agoWaow touching...! :)nevin12344 6 hours agotowards "ONE DAY"..counting start..day one...killr0y51 6 hours agoWAIT, what do you mean that the camera was not rolling ?!smallboy2542 6 hours agoThis was so lovely.But.... a Rastafarian eating a PORK hotdog? Um.... no.niftybean 6 hours agothe kid's school bag is so new, the tag is still on lolmanusleung 6 hours ago 2@manusleung OMG. You noticed that. You my friend are so full of win XDRuGaard77222 6 hours agowhat is the song??? beautiful...ellalwin 6 hours agothen video really match with the song "one day"kinfui 6 hours agoMay i know the artist and title of this song please ??EijiiKimura 6 hours agonice ^^teddycomel 6 hours agoONE DAY WHO KNOW WHEN...Tashtoubica 6 hours agoThank you - Pass the BATON - watch the movie Play it Forward...Random acts of kindness - if we could ALL only care & share what we have & what we know, & open our eyes, ears, minds & hearts we will have peace & joy in the World <3 Peacebuxton59 6 hours agothe funny thing is... the boy didn't go back to retrieve his skateboard... :PMrTonystark8888 6 hours ago 213:10 is just so touching. i almost cried when i saw the smile on the homeless guy ;(TheYk002 6 hours ago16people sink when wearing life vesttootoobig1 6 hours agoBe aware everybody! The kingdom is here and now, just realise it and spread the good news to everyone you know! Spread love so that our world may heal fully and everyone is free to live their life to the fullest!SOCRATES012 7 hours agoSometimes, holding the door for someone is more kindness than what most others give...gfskill2 7 hours agowhat is the music?JOBERALA 7 hours agoi used to be like this, but again i took an arrow to the kneekurtpanic 7 hours ago@kurtpanic bored with that joke.langitgrey 7 hours agoIt takes so little but it affects others so much.. Why cant we do that?chiajll77 7 hours ago 2the dislike bar is so small that i can't see it!SibuTNTcorps 7 hours ago 2Ojalá que todos fueramos asi, ya no por esperar que regrese el bien que hacemos, si no para hacer de este un mundo mejor.I wish all were, and not expected to return the good we do, but to make this a better world.jsiddharthalc 7 hours agothere is an error in this video,it has dislike button...ckjared 7 hours agomay i noe wat is the name of this song???/freemanloverzz 7 hours ago@freemanloverzz one day - matisyahuits in the creditssixthses 7 hours agoAmazing.. One single camera shoot.highlanderX88 7 hours agowhich city is this? I'm moving there!athlon866 7 hours ago 2You want to know why things like this don't happen? Just take a look at the comments on the dislikers...Hypocrisy much? If you can't spare a kind word for someone whom you don't even know, for an opinion they want to express on a PUBLIC website, for a reason that, again, you know nothing about...don't. Just don't.Hate to preach, but this needed to be said.SeraphicBlue9 7 hours ago 9That's life.kimkong05 7 hours agothis only will happen in video~in real life~ when you need help, will they really going to help???edwinchw 8 hours ago@edwinchw that's whats the whole video is all about... do you help every person u see that needs help? do you treat everybody that crosses with your life with love, care and kindness? if you do... good will come back to you... though not immediately, but sometime in the future... karma says so...MrTonystark8888 7 hours agoThis has been flagged as spam showFotokiwi 8 hours agoChain Reaction of goodness will never end..Z666ful 8 hours agoI actually cried.... :'(Litepak10 8 hours ago 3@Litepak10 me 2MyMysteryworldPlace 7 hours agoPay it forward.nurizra 8 hours agoI remember reading about something like this before :) If they can't repay back the kindness to the people who helped them, they'll pass on the kindness to someone else :) And in the end, you'll get rewarded :)PrimoWing 8 hours ago 3At 0:45 the boy puts his skateboard down to help the old lady.WHY U NO OBSERVANT D:Hiaxsy 8 hours ago 12@GrandeLawlacast because her date didnt come or lateletmemakeitjuicyla 8 hours agowhy don't we set ourself a target. Help at least one person a day if we are out.yvliew 8 hours agoWhy did the lady buy the flowers for another lady? Can anyone tell me? o.oGrandeLawlacast 8 hours ago 4@GrandeLawlacast the lady is lonely...maybe because her husband or daughter/son already gone....you can look at the other girls next to the lady table..they were so happy...thats why that girl give the lady bunch of flowers to make the lady feel appreciated!! at least someone care about her!!!!!hannahceceliahc 2 hours agoits similiar to a movie called "Pay It Foward" <3acabuzair2 9 hours ago@cuityzhuzhu67550085 9 hours agoWhy this vid was not in HDedmundtang90 9 hours agoThis has been flagged as spam showthatmetalguy85 9 hours agoThis has been flagged as spam showthatmetalguy85 9 hours agoThe street full of people in need...yunkai09 9 hours agoThe boy forgot his skateboard....why did the girl buy flower for the lady? And why would the waitress suddenly brought the glass of water for the worker? ;-)MichaelTadashi 9 hours agoThe was a movie is called "pay it forward" which is about doing good things for people and paying it forwardfaceless133mhz 9 hours ago@faceless133mhz I watched it too. he died...yunkai09 9 hours ago@yunkai09 I hope YOU die.jasperdel24 5 hours ago@jasperdel24 phillipines bitch gtfoyunkai09 5 hours agoSo what goes around, comes around.watchupclose 9 hours agoIn a monetary system, democracy is an illusion perpetuated to give the populace a feeling of participation in a so-called democratic process./watch?v=4Z9WVZddH9wubuntuguruCOZA 9 hours agoThose that dislike this video are THE INCONSIDERATE ONES. The WORLD IS BETTER WITHOUT THEM....hahalandboo 9 hours ago 45@hahalandboowe should forgive them.because we are kindness @@SeanL0125 6 hours ago@hahalandboo then start working on 80% of the world.RuGaard77222 6 hours agoThis has been flagged as spam showbjorn457 9 hours agomay i noe what is this song??popoio3 9 hours ago@popoio3 its one day by matisyahu :))hahalandboo 9 hours agocan't understand how can people dislike this!! :{sabinsales 9 hours agoif we contribute the kindness we will get back the kindness in returnpopoio3 9 hours agoSpread the lovenibro2010 9 hours ago in playlist Favorite videosi dare to said that 14 people are demonTheZedain89 9 hours agowhy did she put money in a parking meter when there is no car there?Casper3417 9 hours agoTHE ZEITGEIST MOVEMENT! :) 1 PLANET 1 PEOPLE 1 LOVE :)thatmetalguy85 9 hours agoit's like pay it forward :)kata241 9 hours agoi live around these people,,here in heavenRxeren 9 hours agoawesome :dMrBountoh 9 hours agoGood video. But In real life, those kind of attitudes are so RARE ~~Gmac2cool 9 hours agopeople need to be like this....help each other so we can live in peace...darksideillusionist 9 hours agolet spread the lovethe power of a people is strong!!!nibro2010 9 hours agothis video shows that our kindness will be paid............Peter9539 10 hours ago1:15 I thought he was supposed to turn and go back to his friends?dearlyann 10 hours agotoo bad not everyone is like thatHBRJMX 10 hours agoo.O This video really Bright My Day!!Love is All Around :))))MrHopefu11y 10 hours agoThis is what I called Pass On The Kindness =)AprilFool369 10 hours agoComment removedbrendalg4 10 hours agoThis really made me smile. :]jonweisberg01 10 hours agoPay It Forward (2000)seanlee73 10 hours agoDid anyone wondered where did the boy's skateboard gone?cuityzhuzhu 10 hours ago 50@cuityzhuzhu 0.45 (:DoraemonLoverTiine 9 hours ago@cuityzhuzhu it is not gone. he juz left it behind before he helped old lady.Gmac2cool 9 hours ago@cuityzhuzhu he will take it back after helped the old lady(if its not gone)theshaizey 9 hours ago@cuityzhuzhu he put a side ald...Werner3610 9 hours ago@cuityzhuzhu He left it at the bench before he went to help the old lady.ishou80 9 hours agoComment removedSaltShakerz93 8 hours ago@cuityzhuzhu He put it down before he Helped that Old womanjarren97 8 hours ago@cuityzhuzhu See 0:45koolgudguy 8 hours ago@cuityzhuzhu he put it near the post 0:45Aeric80 8 hours ago@cuityzhuzhu he put it beside the lamp post before helping the old woman.mbadidu 8 hours ago 2@cuityzhuzhu He put it at the pole at 0:46Xyf3rse 7 hours ago@cuityzhuzhu It's behind the lamp post. Look carefullyhighlanderX88 7 hours ago@cuityzhuzhu He left it before he helped the old lady... and totally forgot about it.. LOL Replay...reginaldsapphire 7 hours ago@cuityzhuzhu you should watch 0:46ckjared 7 hours agoTitle of the song is One day by MatisyahuMrTotingtinga 10 hours agoVery beautiful video. It made me smile :DWildwrast 10 hours agoPaying forward instead of paying back :)toosleepytowakeup 10 hours agopaying it forward :)appletoez 10 hours agomake it~9 people dont have hearts~~LOL..y the dislikes?elmi0607 10 hours agowhat goes around comes around...TheHermantos 10 hours agowhat song is this?NadineGan 10 hours ago@NadineGan Matisyahu - One dayMrTotingtinga 10 hours agoI like this.GyeBettaFighter 10 hours agoA small video clip yet very meaningful. can make peace through small effortswhiteflower231 11 hours agoComment removedadas91 11 hours agooneday..burgerandcats 11 hours agoWatch the original /watch?v=nwAYpLVyeFUZackAylwin 11 hours ago8 people don't have heartadas91 11 hours agowhy am I crying.. ?tmdwo94 11 hours agoOnly if u can't wakeup & forever sleep in your dream world. Sorry, true alway sad & hurts...SuperBakuTeh 11 hours agoWat song is that? i like itMrRamenful 11 hours ago@MrRamenful"One Day" by Matisyahu featuring Nameless.It's another version featured on the "Listen Up! The Official 2010 FIFA World Cup" Albumjtvlim 10 hours ago8 people are forever alonefaezlimpbizkit 11 hours agoThis has been flagged as spam showTheHelperForAll 11 hours agowhat a goody goody world lol but oh my how i wish if i live like this! god bless us~ ^_^matsuchan92 11 hours agoThis has been flagged as spam showTheHelperForAll 11 hours agoIf only we live in a world like this. <3FaaarPS 11 hours ago 11This has been flagged as spam showTheHelperForAll 11 hours agoThis has been flagged as spam showTheHelperForAll 11 hours agoWhat happened to the skateboard? Did it get stolen? Btw, it would be a nice touch if the contruction guy was the kid's dad...BayernMunich4life31 11 hours agoanyone knows what the song in this vid ??jackblablabla 11 hours agoThis has been flagged as spam showTheHelperForAll 11 hours agoAll he wanted is just a glass of water...adrianowongs 11 hours agowhat goes arounds,comes around...be good to others,and they will be good to you...jakester1998 11 hours ago@jakester1998 That's the universal karmic law.arahantomph 11 hours agoSong title pleaseeee ?Danwonq 11 hours agowatch in hd: watch?v=nwAYpLVyeFUdescription:　Watch as the camera tracks an act of kindness as its passed from one individual to the next and manages to boomerang back to the person who set it into motion.rikool123 11 hours agowow smiles and tears :')BlackzSmoke 11 hours agoIn Malaysia, they still talk about being Malay and Muslim first. Everything else is secondary. No wonder this country is so backward.arahantomph 12 hours ago@arahantomph Really? I mean, Malaysia is going backwards? In what term?muwaimin 12 hours ago@muwaimin Mentality and economically.arahantomph 12 hours ago@arahantomph liedfaezlimpbizkit 11 hours ago@arahantomph you are so damn wrongyou got no lifefaezlimpbizkit 11 hours ago@faezlimpbizkit If you can't argue constructively, then just stfu. You are just like the many people that I mentioned.arahantomph 10 hours ago@arahantomph dude, i live in Malaysia, and i'm chinese bro, btw, i don't have any heart feelings for you..but try to think before you write..not ALL OF THEM..only like 0.01% that took malay and muslims first?..dude, we are one big family..yeah, you got no life :)faezlimpbizkit 7 hours ago@faezlimpbizkit dude, did i say ALL OF THEM are like that ? Read before you reply. Yeah, on the surface it looks like one big family. Then what is all the bumiputra this and bumiputra that ? I'm talking about a higher level, not the general public. But i dun think you can see it coz you got no life.arahantomph 6 hours ago@arahantomph at least they care about their People Bro. Singapore is a Piece of Shi* on the Globe. Being here for 6 years Pisses me off to hell.RuGaard77222 6 hours ago 3huhuhu i cried :(Quibodg 12 hours ago^_^AzwanZam93 12 hours agoif onli the world was like this, it would be so much for happier to live inexodia94 12 hours agowho the hell in this world would like to dislike this video ?Seriously they have to change, like this video.... One day :)manijay89 12 hours agopay it forward...~*~cassidysmomify 12 hours agoThat white guy didnt even put ketchup or mustard on the daym hot dog b4 giving it to the black dude...adipsplayer 12 hours agoi love it..so touchingnelson625 12 hours agobeautiful.MrMarkiepoop 12 hours agocurrently our world is not as beautiful, but everything can start from us~ :) hope for brighter future~ricchthefallenangel 12 hours agowhat song is this? its so nicesaige374 12 hours ago@saige374 "One Day" by Matisyahu =)cassidysmomify 12 hours agoTry this link /watch?v=QbICjWI7Vrw . You judge.Zahyr99 12 hours agowhat are they trying to sell?MrRtek84 12 hours agoThis what Islam teaches us. Islam doesn't teach me the act of terrorism instead Islam teach me how to preach peace. Please don't always mock our religion. Peace. Just my two cents ;)Zahyr99 12 hours ago 2trust me no way tis will happen in the current world.. =) when they see people in need of help, no 1 will give a damn about them lolzSalvanageZ 12 hours agowhat they trying to sell?MrRtek84 12 hours ago@MrRtek84 PSAiFrakAsian 12 hours ago@MrRtek84 loveMrMarkiepoop 12 hours agosimple gestures of light and handy good deeds.demonhill 12 hours agoIt starts with you.soulifyer 13 hours ago6 dislikes??? are they not human??? or are they too arrogant to be kind...DarrenWee92 13 hours ago 20@DarrenWee92 its 9 Billgates730 10 hours agogot tears in my eyes. it is just too beautiful.. i will help people who in need. i will always lend a hand to the poor and hungry.. no more war.. love never fails!theshaizey 13 hours agoif only the world is slow, the time is moving so slow like this video, it would be a happier world.waykitang 13 hours agoif everyone is like this, there will be no more war.MrOhYeahBabe 13 hours ago 10its very beautiful when everybody lend a helping hand to each other <3just beautiful ^^03127 13 hours agofinally, this is the real deal that all of us, human should do and practices in our daily life.manuknapatai 13 hours agoasia also have many very good heart people....and i`m asia...and i proud of it....541523 13 hours ago"LIKE" this if you want our world to be like thisUnstoppableZK 13 hours agoi teared when i saw the guy giving the dude the hotdog. im asian and i am honest dat these stuff dont happen in asia. Im gonna start today.Enterfy 13 hours ago@sayonara123 why asia ? this won't happen if everyone is like YOU , racist bastard!LucaFish91 13 hours ago6 peoples are son of a bitch =)chinhuey91 14 hours agoi just realised that the last guy is the 1st guy who helps the kid. circle of kindnesslolaken12345 14 hours ago 4watching it over and over again !=DNever4EverAlone 14 hours agoWe should make a change... And it begin today! :D Love this video.. :DTialafienea 14 hours agosayonara123 , even won't happen to others, but important thing is from yourself.^_^allentan73 14 hours ago 13This is what should we do.We should start now to do this..to give our generation kindness world.thump up please~to let them know give this world a better generation ~TheToshiro96 14 hours ago 2what song is this? so nicecaracal300 14 hours ago@caracal300 One Day by Matisyahu;)iloveleeminho11 14 hours ago@caracal300 One Day - Matisyahuhankee521 13 hours agoDo you see the dislike bar? Nope, I don't.Chips556 14 hours ago 2LIKE!Crazymike831 14 hours agoif only the world was like this.... :)theeWanderingSoul 14 hours ago 2@sayonara123 den make it happen..PrinceXable 14 hours agoWouldnt your wish be seeing them growing up in a good environment.The kid forgets his skateboard because he's priority is helping that old lady.Why not we do such kind acts,and make the world a better place to live in.Comment,share,like this video to spread the joy of kindnesslycanoperation 14 hours agoSuch a touching video,I Wonder why would anyone dislike such videos?Guys who says it isnt gonna happen in asia?The reason why this dosent happen in asia is because we keep thinking of ourself only.But if we change our mindset,what would the world be?We all want our future generation to live in a world of peace and happiness.lycanoperation 14 hours agowho cried watching this omgwillowsummer9 14 hours agoHow nice if this was the world we live in. Pass the love on this Christmas.bolosantosi19 14 hours ago3:16 the guy smile :)xhappynickx 14 hours ago6 people have no heart.eeldnomsed 14 hours agoThat kid forgot his skateboard...hydrater 14 hours agofake worldragson87 14 hours ago6 of them are not watching this video ! Simply clicked on dislikes, GTFO !TheMelodyMir 14 hours agoTHUMBS UP if ya got a tear in yer eye... PEACE! ~a~AdonisKingAXC 15 hours ago 37To those from Malaysia that said this happens...what are you guys on? Must be some wicked stuff :PSeriously, while I agree that SOME people MIGHT do this, chances are when you leave your wallet behind in M'sia it'll disappear faster than you can turn around to look for it. And helping an old lady cross the road? She'll be lucky if she doesn't get mugged. Get real people- if stuff like this happened everyday, everywhere, there wouldn't BE a need for videos like this.Here's hoping, though. (Y)SeraphicBlue9 15 hours ago@SeraphicBlue9 kindness needs your help on positivity! :)MariMakanBersama 14 hours ago@SeraphicBlue9 exactly the same thing I thought! hahahame951129 14 hours ago@SeraphicBlue9 in malaysia it happen.. but 0.001% ahaha~whitesprada89 14 hours ago@whitesprada89 Betul tu, orang jatuh, kita tengok je tak tolong. Atau kalau orang accident kereta, people will take the number plate of the car and use as sports toto number.rvind92g 14 hours ago@SeraphicBlue9 unfortunately, this is true...xInterlude 13 hours agoAMEN!AdonisKingAXC 15 hours agoAmazing!! Whats the name of the song btw?helloanygoodbye 15 hours agoThis has been flagged as spam showmrskaloot 15 hours agoThis has been flagged as spam showmrskaloot 15 hours agoI just wish those people that I help before will kindly help other people just like I help them.SukkyYiNg286 15 hours agoany idea whats the name of the song?ellengcl 15 hours ago@ellengcl One Day - Matisyahu....yeaahhhh..!! i just help u find the title...now u go help others... ;)mrskaloot 15 hours agoIf only the real world is the same as this............BojanGons 15 hours agoI really like it this MV , i hope this world still have this kind of people!herocyrus 15 hours agoLife will be so amazing if everyone willing to do that.sueteesnowee 15 hours agoGood video. I hope it will serve as a wake up call to the world. If you start treating other kind, then others will do the same to you eventually...:)jennguat 15 hours agoWhat you do for the least of these...JIYkp 15 hours agoThe man that it ended with should of spread the kindness by giving the skateboard back to the kid. Then it goes in circles.NattieGirl99 15 hours agowhy the black guy gotta be homeless?cutepoison98 15 hours agobrilliant ...harindadewa 15 hours agowho in the right mind would dislike this, i mean seriously...>.>alcoholcat 15 hours ago 2IF only this is the world we are inD:MrLegendman13 15 hours agoits not that it doesnt happen in asia, it just doesnt happen to you.FoggyDucks 15 hours agoThe kid who helped the old woman carry the bags forgets his skateboardFiras9224 15 hours agoComment removedazheng66 15 hours agoVery creative. Bhote3 15 hours agoGood vids! I hope we can apply those in our daily life...mashmine 15 hours agoI bet the girl was shit scared when the black guy ran up to her and tapped her shoulder.salibim 15 hours agonever happen in asia? cut the crap out sayonara........siopon88 16 hours agoI believe the 5 dislikes are from Chinese peopleSyncaszil 16 hours ago@Syncaszil im chinese from malaysia & i do love this video.and my 5 friends are viewing as well.. =)johncruiseorz 15 hours agoone day..things will change :)deanglory 16 hours agofake... when a girl finds and return yr wallet, you get lucky with herD00dst3r 16 hours agoOne kindness leads to another. I LOVE IT! And I did smile and feel like crying while watching this video. ^^ErnaNoorFatihah 16 hours agoLIfe starts with you and ends with you .. life is Journey..Make ur journey pleasantashokren 16 hours agoTo help other 7,010,XXX,XXX people in this world, it only just take 1 small step from us. So start it today....saqacaq 17 hours agoComment removedsayonara123 17 hours ago 30@sayonara123 Who the hell told you ? , Asia is Helpful !!MrxAskar 16 hours ago@sayonara123 Why not? IT can start from you =)jamescrisis 16 hours ago@sayonara123 Well, u can be the first to start this act of kindness..=) It takes just one act to start..=)alwynho 15 hours agoIt DO> :)seishirou96 14 hours ago@sayonara123 China* starrymaker 14 hours ago@sayonara123 MAKE IT HAPPEN THAN U BITCH!zerogstudio 13 hours ago@sayonara123 Im one of them! Everyone can do it too!!Ednor23 13 hours ago@sayonara123 some part of Asia, yes. not entirely. manuknapatai 13 hours ago@sayonara123 while its true that asia is relatively more cynical (no racist but honestly in urban China this is very unlikely) i've seen it happen before in Thailand, Singapore etc :)xInterlude 13 hours agoyou people who say stuff like "4 people are retards" or "i would love to kill 4 people" are missing the whole point of this video.xiaopower 17 hours agoWhat goes around comes around.Nice video. Thumbs up!RoyMcAvoy 17 hours agolove the song...=)Junior93501 17 hours agoI Would love to Kill 4 PEOPLE!!!YouDeadMan13 18 hours ago 4@YouDeadMan13 Then u are belongs to one of them... no more kindnesscenturier 14 hours agoYes!!!!Spread the Love!!!!!!!!!!!!!Akandos 18 hours agoi smile and cry at e same time watching this.. i wonder why..neilmond 18 hours agoI Wish all The People was like This People :(YouDeadMan13 18 hours agothat boy forgotten his skateboard.hauyean86 18 hours agoI'm wondering. When will be that "One Day"? *sign.hate12x 18 hours agoin reality, there is always someone that break the chain :)MrIstiko 19 hours ago4 guys who hate this are RETARDSHAYASHI948 19 hours ago 3This is obviously not going to happen.PirateKing1256 20 hours agojust please,stop criticizing on this video.why don't you just do something good today?just advisingSuperPinkpanther11 17 hours ago@SuperPinkpanther11 I didn't criticize the video. You are reading too much.PirateKing1256 17 hours ago@SuperPinkpanther11 Sayonara123 also said the same thing.PirateKing1256 16 hours agopay it forwardJamatastic 21 hours ago 2Jesus said Love thy neighbor as thyself!Loretta7718 21 hours ago4 people must have a guilty conciousxS0u1zx 21 hours agolove thy neighbor as thyself...thanks for the upload..kigitau 21 hours agoTo whom which uploaded this awesome video, just as you know, you my dear friend its the most kind to share this video with us, god bless....Marcuslovearts 21 hours agofor that who dislikes i think you are not human may i know why you do that ??MrHamadaHelal 22 hours agothumbs up if u smile from the heart when watching tis video =)xlucif3rx 22 hours ago 3@Zeemas no, the man at the end is the same as at the beginning..TheSteini96 22 hours agoWithin ourself, start a chain of kindness..nazriesefira 22 hours agofaith in humanity restoredtetrachloromethane 22 hours ago 3love this...just wish it were that quick!faeriekat1 23 hours agothis is better than aviciirabbitr3st 23 hours agoif you made a good things , it will return to you in no time..grooggs 1 day agobut no one said thank you in after they get helpedEmailSinoWong 1 day agoInspiring.ChewyBite 1 day agoWhich street is this? I'm moving over.tomiverycute 1 day agodoing a small favor for the others, making the world a better place,One Day we all grow old, and when we do, would you rather,be watching the world coming to an end, filled with hatred and anger,or a peaceful and harmonious world, where,everyone has the heart to help one another,feeling loved wherever you go, wherever you are.chinesepaladinrox 1 day agoI don't give a f**k if it doesn't happen in reality.I just wan2 do it.igniz17173 1 day agoWho else smile when watching this video throughout?hengyijun 1 day ago 36let love fill this worldwulin0841 1 day agoTotally awesome! Single take!j0hnsonx 1 day agoThe awkward moment when you realise that the boy never took his skateboard backuberliang 1 day ago 21@uberliang Yeah, I was like "Oh shit, kid's gonna be sad."Eghhhh 23 hours ago@uberliang he picked it up, then he dropped it off at the tree, prolly headed backAzner2254 15 hours ago@Azner2254 But he walked off in the other direction!uberliang 15 hours ago@uberliang hahaha you're right. dayumAzner2254 11 hours ago@uberliang oh wait, he went in the other directionAzner2254 15 hours ago@Azner2254 ok he went to catch up with his friends and ask them to wait up and then he goes back get his skateboard ok???yvliew 8 hours ago

Cute Video: Every Dog is Shuffling

2012-01-22T02:36:00.000+08:00

Does this make you "wow"?Hope this cute video can make your day beautiful.

What is Gross National Happiness (GNH)? Explained by Morten Sondergaard

2012-01-15T03:26:00.000+08:00

What is "Gross National Happiness" explained in 3 minLet's hope more countries will work towards GNH instead of GDP.

There is always miracle

2012-01-01T01:19:00.000+08:00

This is a very beautifully done animation.Yes. Miracle can happen with the advancement of Science.What matters most is to pick yourself up after falling down.

Cute Girl - Price Tag Cover by 3 year old Gabrielle

2011-12-16T00:51:00.000+08:00

Cute little girl singing!Comments:ahh naa noo PRRRRRRRIIICCCCCCCEEEEEEEE TTTTTTTAAAAAAGGGGGGGG!!!!!!!!!!!!!!! cutedaniisawsomeful 27 seconds agohow cute ! :)dairyqueen1998 8 minutes agoshe's so cute !! i love herdinaki123zouzounaki 11 minutes agocrazybiilgin 12 minutes agode banii jtie sa zik :)))))DaNyDaNy560 12 minutes agoawwwwwwshannonluvsumiley 13 minutes agoEVRYBODY LOOK TO THE LEFT!!!! EVRYBODY LOOK TO THE RIGHT!!!!!!!!!!! ;) xx shes so adorable xoxoxoxoxoxvicplum123 16 minutes agohow can u dislike this ? ZigecTheFreak 21 minutes ago in playlist LikedI never EAT AT NIGHT :DA-d-o-r-a-b-l-e :)MileyCyrusTheBest101 23 minutes agoahhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhdollyadeoye 29 minutes agoIt's sounds like she says:Look over there, some friesi'm gonna eat at nightLalala lalalaStop the noodles at nineSoooooo sweet!!!TamanaVevo 29 minutes agoit is full of sweethacobamer 32 minutes agomoney money money hahahahahhaha $TheSweatestBitch 32 minutes agoSsssooooooo ccccuuuuuuuttttteeeeSuperBadoori 43 minutes agohehe laughed a lot :DDtymex123s 44 minutes agoDamn, I think Justin Bieber has goten himself a compatitor xDUntitledScars 44 minutes agothis is the cutes thing ever! >< <3PlonkerStar 49 minutes agoshe's so cute <3nata05091990 58 minutes agomegaa , ona jest rozwalająca .Megaa megaa ;**karoliinqqa 1 hour agoComment removedkaroliinqqa 1 hour agoOh My God she's adorable and she's got groove...U rock BabyGirl :0)MaikaDee 1 hour agohow cute *-*rachelheldenhaft 1 hour agoOMG she´s soooooo sweeet!!o.oSweetGirl6Love 1 hour agosweet!RaicoEbel 2 hours agoaahhh love :')ApplesAndDaisies 2 hours agoqe gracinhaaaaaaaaaaaa jimkasuya1 2 hours agowow great :DJoyceMaryLy 2 hours agoahh soooo cutecharzz1999 2 hours agopritty goodcrazyfrog1oo 2 hours agoAAAAAAAAAAAAAAACHVeertjee00 2 hours agosooooooooooooooooo cuteeawesomemess1 2 hours agobetter than justin bieber ;)MusikTv95 2 hours ago 15@MusikTv95 hahahabudakcomelish 2 hours ago@MusikTv95 Way moreMultiJC90 49 minutes agohahaha !! very cuteeee :D <3BsrMhr 2 hours agomoney, money, money. *Stops for a while* Money, money, money. HAHAHAHAHAHA, So cuteee~JoycelynHiga3001 2 hours agothat cute! greater cuteness I have ever seen! own ..lknmee 2 hours agoShe wants that Dad, GET IT. 0:22. lolch3ckth1s0ut1 3 hours agothats soo cute.love it.<3 how could anybody dislike?:Othemillyfication 3 hours agoaww cutekaari0 3 hours agoAwwww thats adorable well doneL96A1iiMontagez 3 hours agoMore daddy moorree XD<333333 cuuuuttteeAnneBanne99 3 hours agolaaalaalaalaalaaala HEEEEEY Lalalallaaaaa HEEEEEEY, so cute.melissaa13xkus 3 hours ago 15@melissaa13xkus Hha XDAnneBanne99 3 hours agoWhat it sounds like: Look over there they got some fries Go and eat at night doodeedoodeedoo just stop the noodles and cry Everybody looks to the LEFT everybody looks to the RIGHT feel that yah were paying with luck tonight ............... money, money, money ............... money,money,money wow dance pwice tagsgnorush 3 hours agowow very niceGerula94 3 hours agosooooo cuutee lookss like my little sisellePHAM 3 hours ago@101SparkeygirlJealous in what????a guy that looks like a girl and sings like somebody is trying to strangle him xDmarjoh1024 3 hours agoall i heard was: there is no better , a want to sleep at night.........ellePHAM 3 hours agoi don't like.. :DThEnDiary 3 hours agoFor a three year old, that is amazing! I love how she knows left and right!RashmikaClavain 3 hours agovilken låt är det?TheRyttse97 3 hours agosweeeeet.*-*MsZuckermaedchen 3 hours agoCute but you can only hear some words:P she is soo adorable so i likedsssslc 4 hours agoang cute hahaha !!ericacute01 4 hours agoahh so adorable!suzanxx1 4 hours agohow sweet she is ;DJessiSch0k0keks 4 hours agobetter than Jus... nah, why would I say that? Everybody know this...RHAFerreira46 4 hours agoWow 3yr old knows her left and Rights.D2A2n2y 4 hours agoWHAT A LITTLE RETARTED ANNOYING DEVILISH FUCKING GIRL.bdahits11045 4 hours agoadorable! she makes me smile :)sarahlovesbeauty7 4 hours agoi loveeee it ' she so much cuteeee !!!~israel the Queen !ישראל שלייטה (:shanyny3 5 hours agoi love how she says bling a blingavianministry123 5 hours ago1:47 - " More daddy, more" ?GucciDivah 5 hours agoshe needs to learn the words.blueberryjupiter 5 hours agoShe is soooooooo cute =DD <3Just9Monika 5 hours agoLol how sweet she is so cute hahahahabumblebeegirl2000 5 hours agoShes just so cute xxBrianlicker2012 5 hours agoAmazing!♥She is soo sweet, will you be mine Baby?:DVIPJojoMaus 5 hours agoshe's so cute!!!!!!!!!!!!!!missesthercool 5 hours agoADORABLE LMAOEllybananas 5 hours agoshes so cutesaramaishasings 5 hours agosweeeeeeeeeeeeeeeeeet :D :DMrMartin989898 5 hours ago:O oh dear the only things she said right is money money, cha ching - ching and bling blingRenzky 5 hours agoawwwsweet howcute and shes ADORABLE!!!FfionS1 6 hours agoI disliked it because it hurts my fucking ears.mrsmoothcruiser 6 hours agosoooooo cute she's adorable ;pall people dislike that are crazy it's just cute <3GaelleBreezy 6 hours agosoooo sweet (:winxgirl2000 6 hours agosüßßßßßß ;* dascoolekind 6 hours agoso cute!!!!fB2530yTuZeR23 6 hours agoow!!!!!!!!nice one.....1loverukia07 7 hours agoShe is so cute and the reason she cant sing is BECAUSE SHE IS 3!!!!!1212ILUVME 7 hours agoso cute...love it much......!even though i can't understand,stl shes cute....1loverukia07 7 hours agoLOLundeadlive007 7 hours agoso cute*__*96Canii 7 hours agoYOU SUCKKK BOOOOOOO TROLOLOLOLOOL >:Dmixtraack 8 hours agoThis has been flagged as spam showMrFrozenThrown 8 hours agosupper cute SuperSamira28 8 hours agotena para PRICE i nena nina NIGHT! NI NA NA NE NA TA every body look to the left! every body look to the light XD... I DONT UNDERSTAND..CDOC39 8 hours ago 16@CDOC39 ha ah aha ah ah aha haaaha ha ah yeah she is saying thatKemjFlores28 8 hours agoHow can anyone not love this, I have watched it many times and think its the cutest thing that I have ever seen! Just adorable!NiceGirl47100 9 hours agoawww! bet she's gonna be a good singer when she's older.Jellybeanifyer 9 hours agoCUUUTEgembelobosok 9 hours agoWhat an adorable kid. :)analynnjois 10 hours agoaaaahh Super cuteee(lll)TheMassey35 10 hours agodsdsadsgdsgdadahdydeyddyedyedfgdgdhgdsjfgbdjgbfdsgbfdgbkdsjgdkjfgdjgdfsgsbdghdfskgjdsfgbdfsgbdfsggkdsgfhdsgbfdsjgbfdjgbdskjgbdjg MONEY,MONEY,MONEY,MONEY,MONEYYEH.DFSDFSDFDFVGFVDFVDFDFGDFDFDFDFBDKLFDGKGDKGBDGYEH.FDFDJBFGDJBGJDGJGJDFGBDGDJGFDGKOHHH.. SO CUTE :Dkarenayson 10 hours ago1,749 people are canadians.Sean0fWar 10 hours ago 2so cute♥♥hewvip 10 hours ago1,749 people are jealousMsCherry1999 11 hours agowoahMsCherry1999 11 hours agoi m just wanna say shit to all the people who dislike itmoekhantminlwin 11 hours ago1,748 are zombies!naniniish 11 hours agoprice tag or priceless ? nabilfaizi 11 hours agoshe knows what rhythm is!cacagion 12 hours agoเก่งมากjom07276 12 hours agololprincessjada007 12 hours agoawww sooo adorablef4m0uzashes 12 hours agoOMGGG...soooooooo CUTEEMegRocks0 12 hours agoThis is soo adorable!! AwwwNikki9dr 12 hours agoThis has been flagged as spam showminkao3 12 hours agoWhy would you dislike that? She is adorable! (:fooksyisagun98 13 hours ago 35

Cute kids - Don't touch me!

2011-12-03T04:45:00.000+08:00

Big sister deals with her annoying little brotherCute kids!

Beautiful Teacup Female Maltese

2011-11-23T21:58:00.001+08:00

Comments:

<3 i cant another word....? it so much i will die!?
daysi0319 1 month ago 3

so cute!!!!!!!!!!!!!!?
urilcamm 4 months ago

awwwwwwwwwwwwwww she's so cute <3 ?
justinbieberizhot100 4 months ago 2

wheree can you buy this kindd of dogg for? a cheapp pricee??/:)

gracekim1000 4 months ago 4

i know if i brung tht pup to show? n tell they'd be like wats that ball of fur doin here lolz
mzallstar1234567 5 months ago 3

GAAAAAHHHHH SOOO CUTE IMMA? GO CRAZY IF I DON'T GET ONE!!!!!!

TT_TT
abbykinnz 5 months ago 5

ahhhhhh omg i wished it was my puppy:((?
love23kl 6 months ago

is she? for sale
purplelili1 6 months ago

what a cutieeeeeee ^_^ how much did it cost?!? i want to buyyy? one theyre veryy cute
xhoke96 7 months ago

AWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWHHHHHHHHHHHHHHHHHHHHHHHHHHHHHEEEEEEEEEEEEE!!!!!! :3 <3 <3 <3? <3
DubstepKittyKoda 7 months ago

Soooo cute!!?
alluringinnocence 7 months ago

i would? like to have the same please!!! i adore it!!!!can i have info???
bellydancervivi 7 months ago

Shee is adorablle!! I literally squealed(sp?) at herr cuuteness!!! i justt wanna takke her hoome!! <33 So cuute hoow she keeps bakking away froom the edge [= Most videos i have seeen of them actualy rolling aaround jumping off, but awwz! This onee iss adorable x.x imma? stopp watchinng pup vids or else imma be upp all nighht lol [=
AnIiMeKitty 7 months ago

ohhhmyyygoshhhh she? is precious <3
littlemissrissy 8 months ago

this has to be the cutest dog i ever seen!!!!!! omg its so cuteeeee!!! its hypnotizing by it's cuteness!!! gosh i want it!!?
katiifavz3 8 months ago

I'm gonna get one and name her Pixie.

P.S. that names been in my mind since I was? 7
Treyskywalker77 9 months ago

My Bella looks JUST like? this. <3
cutepurpleprincess 9 months ago

hey? does anyone know where they sell heese in london at all i really want one !
loisgeorge123 10 months ago 38

im steeling it lol ?
MusicIsMyWorld347 11 months ago 127

ADORABLE! i really want a tea-cup dog but there? sooo expensive !
beachbabie020 11 months ago

FUCKING D'AWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW?
hitlermustache 1 year ago

i would like to? buy her!!!

if you are selling her how much is she?
x3dontknowxoxo 1 year ago

AWWW, She's so adorable! Is she for sale? ?
cindyxella 1 year ago

awwwwwwww!!!!!!!! <3 i? want! :)
peacexlovexmaddiex 1 year ago

Smile because life is beautiful - 3

2011-11-15T21:00:00.001+08:00

Smile because life is beautiful

Project RunThruSingapore

2011-11-01T13:35:00.000+08:00

By owner:Uniquely and entirely shot on Steadicam, RunThruSingapore expresses our love for Singapore.Simulating the run through Singapore in a day, we want to show an epic journey of a young man exploring the beauty of Singapore by running across the entire nation, passing through places that are new, old and even unexplored by Singaporeans.

Comments from public:

    awesome & fantastic video featuring the lives & spirits of Singapore...shared with my overseas friends and they loved it... just a small suggestion: use those past NDP theme songs as the background music/song. ..that would be a perfect gift for 46th NDP or anyone who watch it in the future...excellent work, guys...:)
    san90520 1 week ago 3

    wah lau, watched this vid 20 times already and i'm still not tired of it...
    bastronut 1 week ago 2

    Mute this video and pause it at 0:13, play the local band Electrico's song Faces: youtube.com/watch?v=OOcCeRQQFFE as the background soundtrack for this video. sit back and enjoy. makes this video a true carthasis and a reflection of being singaporean.
    frogboychickenrice 2 weeks ago 4
    Comment removed
    frogboychickenrice 2 weeks ago

    thumbs up if you recognize all of the places he ran to :)
    waterpolorox 2 weeks ago 4

    I feel that this is one of the best Singapore-made clips that I've ever seen thus far, surpassing the standards of Mediacorp and their NDP videos!!
    tianhua1993 3 weeks ago 4

    I'm an overseas Singaporean. This video makes me more well-disposed towards 'home' than any number of national day videos.
    zonkaroonie 3 weeks ago 7

    awesome shoot! so nice to see familiar places but in a different perspective..
    ilovefourlettersword 4 weeks ago

    @SteadiProductions How did you film it so steadily if you were running with him?
    XreflectX 1 month ago
    This has been flagged as spam   show
    tianhua1993 3 weeks ago

    wooooooo hot boy:D cblock <3

    anyonehere13 1 month ago

    Hey all! There will be a meet and greet session on the 4th SEPT for everyone to find out more about Telok Blangah CC YEC, Project RunThruSingapore & SteadiProductions.

    We will be launching the "Making's of Project RunThruSingapore too"

    Additionally, there will be a live demonstration on how to operate a SteadiCam.
    SteadiProductions 1 month ago

    ah, this is kinda nostalgic
    setsunaftw 1 month ago

    Awesome job! Thank you so much. I want to share with my friend. Pround of you all..thumb up

    melodyjouful 1 month ago 2

    How did you all get the steady shot while running??
    Drummer8nimation 1 month ago

    Sengkang at 5:03
    Drummer8nimation 1 month ago

    It made me fall in love with Singapore again. Brought a tear to my eye this quiet morning in Tokyo...can't wait to go home. Thanks for making it. It's fantastic.
    terminalcase42 1 month ago 3

    @terminalcase42 Glad you liked it... I'm sure you'll get home soon!
    thevideographer90 1 month ago

    oh my god. i wanted to do a video like this too in stop motion. someone beat me to it! D: great vid!
    titanlyy 1 month ago

    Well done ! Steady lah.... ! :D
    beyon13 1 month ago

    I like how s'pore is the only country that you can run around in less then 8 mins..Awesome!!!

    sooriyah007 1 month ago

    Good concept and good effort! :)
    Lxmby 1 month ago

    awesome video man !
    TraceurJY 1 month ago

    Beautiful.
    alloaw 1 month ago

    Awesome job ! Just curious, how many days did you take to shoot ? :)
    Hafiz93 1 month ago

    @Hafiz93 It took us about 6 months to complete the shoot!
    SteadiProductions 1 month ago

    This video should be renamed as .. Around Singapore in 7:36 mins
    ChiliKeY 1 month ago 2

    Nice video, would be perfect if he can run in LKY's and the ministers' houses.
    graysg 1 month ago

    i super like! fantastic idea!
    eminozy 1 month ago

    luckily he did not run on PIE.........
    helltoturingforever 1 month ago

    Hats of you! Great job!
    babusaj1 1 month ago

    Good job guys!
    ahkl77 1 month ago

    great video, get a great tour of Singapore this way.
    gopher3737 1 month ago

    what's the triangular building in the background at 1:24? it's one of my favourite buildings in Singapore but I still haven't figured out its name!
    puddleofgooify 1 month ago

    @puddleofgooify It's the Golden Mile Complex building ;)
    SteadiProductions 1 month ago

    loved itt!
    eldridtan 1 month ago

    Nice Video. Some of these places I even didn't even explored, haha. Good Job!
    SAD2656594 1 month ago 2

    this video is awesome! the entire idea and concept is absolutely refreshing and beautiful. A million round of applause to the production team
    iONGGY 1 month ago

    this is beautiful :) well done!
    jngsh 1 month ago

    Ying Quan, just ignore them. You're a running demi-god! ...second only to the camera man who presumably was running backwards! This is fantastic! Six months well invested in my book. Thank you all so very much!
    johnnymcsporran 1 month ago

    Thoroughly enjoyed this video, especially the part on Kranji War Memorial. I went there when I was a soldier and that felt especially meaningful. Would love to go back there to pay respect again.
    thelastrebirth 1 month ago

    What a brilliant concept & video! Kudos to Jason and Ying Quan for directing & producing such an original and moving vid!! A truly Made-In-Singapore project that I can proudly show off to foreign friends!

    (Hwvr, i do wish that you had inserted a part where the jogger buys some flowers from the market or something, so that there's a context to how the flowers suddenly appeared in his hands when he placed them at the war memorial. Also, is there a reason why yr 24-hr jogger wasnt credited?:)
    jellycomics 1 month ago 8

    @jellycomics Thanks for your praise! =) Well! The Runner is Ying Quan! He is the producer and runner =)
    SteadiProductions 1 month ago 3

    i wish you guys could add captions for all the locations (i know it's a lot of work) - ashamed to say i can't identify all of them. but fantaaaastic video. thanks for renewing my love for singapore!
    zephyr84 1 month ago

    @zephyr84 Hello Zephyr! I detailed breakdown of the location can be found in the google map placed under our video!
    SteadiProductions 1 month ago

    Great concept. Good and admirable effort. However, only one criticism from me is - the crossfade editing is badly executed. It would better serve with good and fast straight cut.

    Overall, proud of the video!

    Keep up the good work.
    davade2 1 month ago

    how did u film him running? were u on the back of a bike or something?

    Zetality 1 month ago

    @Zetality Hi Zetality, we flipped the LCD monitor of the 60D to the side and ran together with the runner!
    SteadiProductions 1 month ago

    @SteadiProductions then how come so stable while you film and run?
    rykalbapakkau 1 month ago

    @rykalbapakkau Read the comment. It says shot using Steadicam.
    ZonMng 1 month ago

    @rykalbapakkau Read the info. It says shot using Steadicam.
    ZonMng 1 month ago

    Thanks for your support guys! Do support our passion for Singapore by sharing our video with fellow Singaporeans and also your International Friends!

    Do follow us on our youtube channel & like our Facebook page
    SteadiProductions 1 month ago

    i see my neighborhood! <3 the vid. thanks.
    bajero 1 month ago

    The video was very well flimed. It shows a lot of planning and effort putting in.

    Unfortunately the guy in the video don't looks like a runner. He got no running style. Should get a real runner that glide like those Kenyas' long distance runners and with proper running attire. Then this video will be a very captivating one. Showcasting our beautiful island.
    cityhousefly 1 month ago

    pruss wan for awesomeness
    weedee88 1 month ago

    Thanks so much for producing this clip. Even when I'm out of Singapore, it feels home watching this.
    eclipsingly 1 month ago 2

    great job..makes me feel like running too!
    auzistar 1 month ago 2

    A wonderful production gues... well done! I love it!
    avongxay 1 month ago

    awesome stuff they should have shown this at NDP 2011.
    neon0mega 1 month ago

    Awesome video! Shows that there are still some places left that I've yet to explore in Singapore. :)

    AshrafSpore 1 month ago

    Lovely video :)

    I do agree. There really is a lot of beauty all around, a lot going on on this little island. The ironic thing is that I didn't grow up in "that Singapore" - I never went to Kampong Glam or Little India as a kid. I discovered these places as an adult, and I like them because they are evocative of bits of local history that're exotic to me.
    lkaiping 1 month ago

    Amaaaaazing. Looking forward to RTS2 - The places we missed during RTS1.
    astrodotsg 1 month ago

    This is the best video that STB never produced. Also a very lovely paean to Singaporeans.
    piggnant 1 month ago

    this is awesome! it was fun guessing which part of SG he was running thru! Im based in KL now, and even tho Im in a neighbouring country, i dont get to go home often enough. Now this has put a huge smile on my face on this lovely Sunday morning. Good job guys. a simple concept but well executed. :)
    fidahrashid 1 month ago

    Locations are all jumbled up and the guy didnt perspire at all makes it a little weird. BUT nonetheless awesome effort made <3
    faithloh1 1 month ago

    Pandan reservoir! 2.4km run for rv students :)
    athena149 1 month ago

    might have worked better if the guy didn't run like a girl.
    saetria 1 month ago

    Very very nice! The guy looks like he would have done a pretty good marathon time. How did his hair stay so perfectly coiffed during the run? ;) BTW what official run did he run through when he was at the Padang?
    enp01sg 1 month ago 2
    Comment removed
    sirspiff 1 month ago

    Wow!
    fujie94 1 month ago

    this is da bomb:DD

    niebuhrnobfear 1 month ago

    who in the right mind will dislike this vid?!
    tans0249 1 month ago

    RUN FOREST RUN!!
    therepublicist 1 month ago

    The credits section wrote "Unmarked Guitars" -- I think that's a mistake.
    muhammadhirman 1 month ago

    So many nice places that I don't recognize! Good job with the video.
    Arktos08 1 month ago 2

    Awesome!
    muhammadhirman 1 month ago

    Take how long to complet the run :)

    georgeporky 1 month ago

    @georgeporky It took us 6 months to film this =D
    SteadiProductions 1 month ago

    wa lao eh, I wanna do that, but I can't run further than 100metres
    IAmNotFatdotNet 1 month ago

    yet another production from ruicheng and team. i like it :D
    ibeee 1 month ago

    omg i saw the park beside jp and boonlay shopping centre! LOL.... nice one!
    marshtuber 1 month ago

    any one can tell me wad that 2 song name ?

    iphone4999 1 month ago

    @iphone4999 It is in the video description, just click on the 'Show more' tab..
    odomisauq 1 month ago

    did he run to the zoo? where did you find this guy, NO SWEAT!!! HAHA but this is an awesome vid. the editing was great, the music was great, lighting. BRILLIANT!!!

    i wish i'd thought of this.
    stjap19 1 month ago

    @stjap19 Yo! Nope we did not run the Zoo! Thanks for Supporting us =)
    SteadiProductions 1 month ago

    @SteadiProductions will look forward to your up and coming video.
    stjap19 1 month ago

    okay who wants to plan a running route based on this video?
    jkai27 1 month ago

    Overall it's awesome, the songs go very well with the video as well. kudos to your efforts. I have a humble suggestion, maybe next time can feature local music ? Especially those local indie artistes like 53a and Inch Chua. Trying working with them if possible, it would be mutually beneficial for the creative industry here in sg. =)
    odomisauq 1 month ago 2

    @odomisauq Hi odomisauq, yes it would be great to work with local indie artistes! It was our original choice to use local music in the first place, but lack of time to source and work out details meant using The Jezabels, who are really good :) If I had a choice, definitely local! Thanks for the band suggestions!
    SteadiProductions 1 month ago

    By the way, I'd be sharing it with my family and other friends as well ;)
    ff9garnet90 1 month ago

    @ff9garnet90 Hi ff9garnet90, thank you for the support!
    SteadiProductions 1 month ago

    Wonderful video =).Give me a tight feeling to my chest and make me feel that, once again, I'm proud to be a Singaporean. Great job guys =)!
    ff9garnet90 1 month ago

    This is beautifully done. :D

    Does anyone know what the building at 05:19 is?
    geeksomeguy 1 month ago

    @geeksomeguy 5.19 is Orchard Ion =)
    SteadiProductions 1 month ago 2

    Lovely video. But wai u no support local music :(
    plovery0 1 month ago 2

    @plovery0 We will definitely do that in our next video :)
    SteadiProductions 1 month ago

    IS HE FOREST GUMP?? he looks like he runs funny.
    jilun 1 month ago

    2 people are foreign talent.
    kenilim 1 month ago 35

    awesome video. gives a warm fuzzy feeling inside especially for those overseas who are missing home. =)
    linkingd0ts 1 month ago

    Great concept! But found the guy bowing at both the Kranji War Cemetery and Civilian War Memorial a bit strange (esp for the civilian war memorial- considering it's a commemoration of those who perished during ww2) Overall, nice video!
    plxn 1 month ago 2
    Comment removed
    plxn 1 month ago
    Comment removed
    plxn 1 month ago

    Well done. Makes me feel all warm and patriotic inside
    johnsmith1330 1 month ago 2

    Yes!
    DotaLord1993 1 month ago

    this is lovely, Happy Birthday Singapore :))
    ghostbabe38 1 month ago

    Great video! If we put all our political affiliations and typical Singaporean cynicism aside, we can take a step back and actually notice that we have a rather beautiful country. Makes me miss home a wee bit. Happy birthday, Singapore! Lots of love from Pittsburgh! <3
    Eghhhh 1 month ago 2

    Darn got to rewatch it for the scenic shots I missed. Spent too much time looking at his chest
    yardypoop 1 month ago 22

    @yardypoop cuz his chest says zoom?
    zhiyang434 1 month ago

    This is a nice and creative video, but a little too long. Nevertheless well done
    vinvgohg 1 month ago

    very well done guys!
    wubefrub 1 month ago

    This is one of the most beautiful and touching videos I have ever watched as a Singaporean.
    1337hacks 1 month ago 2

    @1337hacks Thanks for your support! HAPPY NATIONAL DAY!!
    SteadiProductions 1 month ago

    Nice work Jason! Glad that I met you last Sunday :) (60D Battery grip eh?) See you again soon!
    aochengsu 1 month ago

    Great job on the video. With all that is happening in Singapore now, somehow your video has made me proud to be a Singaporean again. Thank you. Happy National Day
    daniel7521 1 month ago 2

    @daniel7521 Happy national day to you too! Thanks a lot for your support! Let us all be proud of our beautiful country and show it to the world!
    SteadiProductions 1 month ago

    heeeeeeee
    doggie1993 1 month ago

    also @5.43 would have been awesome if they jumped on that passenger bike and filmed it, would be nice to add a little comedy in it :)
    thesoftmint 1 month ago

    i like how he doesnt sweat at all
    endot 1 month ago 5

    @endot its the shirt XD really =D
    SteadiProductions 1 month ago

    Wonderful video! Thank you so much for your time and effort making it, I really appreciate it!

    Living overseas, I never realised how much I missed Singapore until how emo I got when watching this. I really teared up after all the different scenes that I've personally walked and been in.

    Fantastic job :-)
    rinaz 1 month ago

    @rinaz Thanks!!! Do check out the google map for the locations so that when you come back to visit Singapore again! You'll see them =)

    Do share it with your overseas and show them the Beauty of our Country!!
    SteadiProductions 1 month ago

    Happy National Day to All! Do lend us your support for our simple project by sharing it with all your loved ones and international friends too!
    SteadiProductions 1 month ago

    Wow, on the faster scenes, the steadi-cameraman must really have quite a strong arm D:
    wksim91 1 month ago

    @wksim91 Our director Jason need a lot of arm training just for this HAHA
    SteadiProductions 1 month ago

    This is a really wonderful video. (Personally I would have used Martin Solveig's 'Ready To Go' song for the music but that's just me). I thought I knew most of Singapore but you have shown me a lots of sites I have yet to visit! THank you! Also, having the map of his run is very helpful. Can't wait to use this info in my next visit this December!
    TorontoViewer 1 month ago

    @TorontoViewer Thanks for your kind words! Do lend us your support and help us to spread our video around!
    SteadiProductions 1 month ago

    Man I was hoping he would run on the water from Ubin back to Changi Ferry Terminal. Disappointed.
    chelidagreat 1 month ago 2

    I was thinking he could have swam back to sg.
    a1beng 1 month ago

    Awesome vid! But why go from jurong to woodlands then back down to gombak then to ang mo kio. Lol.. It's not consistent. But the other places are all linked and consistent.
    xiangyao1 1 month ago

    @xiangyao1 Haha! We tried to somewhat ran a complete round but its quite difficult to link in the end
    SteadiProductions 1 month ago

    what about Pulau Tekong mate!

    Overall an awesome job guys =)
    tohwushu 1 month ago

    @tohwushu LOL that place can't be filmed sadly
    SteadiProductions 1 month ago

    Danny MacAskill - "Way Back Home" go check it out. the video uses the same song and its also about this man cycling around somewhere. (as opposed to a guy running)
    ngzhongqin 1 month ago

    @ngzhongqin Yea! we got inspiration from that video too =)
    SteadiProductions 1 month ago
    Comment removed
    ngzhongqin 1 month ago

    is he wearing a bra?


    thesoftmint 1 month ago 2

    @thesoftmint No the actor is not wearing a bra =.=
    SteadiProductions 1 month ago

    @SteadiProductions haha i just kidding, nice video anyway, althought u should get a shot of tekong, quite a intresting site tbh, i am sure that if u asked u might have been able to do it.

    thesoftmint 1 month ago

    @thesoftmint lol now that's all i can see!
    omgsianz 1 month ago

    @omgsianz Thanks! Help us spread the msg =)
    SteadiProductions 1 month ago

    Great job Mr Tan! Now I know why you are all that busy during our SAGE rehearsals. :D

    Thanks for your support and guidance albeit your busy schedule!!
    andrew651992 1 month ago

    @andrew651992 Help us spread the love in JJC too!
    SteadiProductions 1 month ago

    how many months it took to make this video? :O
    mingz 1 month ago

    @mingz It took us 8 Months in total, 6 Months to carry out the filming =)
    SteadiProductions 1 month ago

    That dude didn't run through Singapore
    firdaus125 1 month ago

    @firdaus125 Well we didn't literally ran through Singapore on foot, but we indeed travel through almost every single part of Singapore!
    SteadiProductions 1 month ago

    Great work. why not geylang...
    mock83 1 month ago 4

    Hey There! Thanks for your support! We did film geylang but the scene didn't turn out nice unfortunetely
    SteadiProductions 1 month ago

When you think it's impossible

2011-10-21T10:23:00.002+08:00

Mr. Hu is a big guy, 183 cm and 81kg, this will make his performance even harder.

Smile because life is beautiful - 2

2011-10-12T20:58:00.002+08:00

Keep smiling, because life is beautiful

Cute song for beautiful you

2011-09-20T09:55:00.001+08:00

LYRICS:
Chorus:
Today I don't feel like eating Fish and Chips
I just want some curry instead
Don't feel like eating pasta cold
These asian noodles smell so old
So today I'm gonna feast on this curry
All night long...

Nave:
I'm gonna pluck some curry leaves
And put em in my pan
Add chicken breasts
And mix with my hands
Nobody's gon' tell me I can't

This chicken curry
So yummy
Tandoori turns me on!

John Bala:
Now there ain't no curry like a chicken buryani
Cause a chicken Buryani don't smell
I just dropped in with my nephew named Vin
Cause the bugger isn't fed too well...

Vini:
Nave this curry is great
But I need a pappadum
Better than a steak
Screw the burning in my bum
I could eat this every single day

Yes I smell it
I gotta get it
So spicy all night long

Smile because life is beautiful - 1

2011-09-10T20:52:00.002+08:00

Smile because life is beautiful. Keep smiling.

Beautiful Voice, Beautiful Soul

2011-08-20T18:30:00.003+08:00

[Korea's Got Talent] tvN 코리아 갓 탤런트 Ep.1 Sung-bong Choi

It doesn't matter who you are, as long as you have a dream, persist it.

Comments:

I heard he went to Art High School, but he could barely graduate because of his financial problem. I bet he couldn't get private lessons or support for his vocal training.. I admire him even more!!!!!!!!!!

I seriously cried when he started singing.. just wanna give him a Huge Hug!!
Bring it on Sung-bong!!! :)

I am really proud of you as a Korean. God bless you.!!

this young man is truly inspirational..well done..god bless you..all my love to u from Australia...

I sometimes think that this new media technology is just a little too much, but then I see something like this , which without this techonology I would never would have had the pleasure.... Wow! you may not have been blessed as a child, but you have been blessed with talent, I hope you find the road to success and recognition through your amazing gift, many hugs and blessings from Australia!

so unbelievable. good job bro, you're amazing.

I am a classical singer, and a Filipino. I want to extend my heartfelt thanks for this wonderful 8-minute story of inspiration. It made me proud to be Asian. Praise God for wonderful talents like this. More power Sung-bong Choi, more power KGT.

He touched my heart as he sang from his soul. What a gifted singer

It is the soul, crafted by Sung Bong Choi's trials that lend beauty to his rendition of Nella Fantasia. Comparing him to a Sara Brightman only proves his talent but the two are very different, not that he is better - his is a wonderful performance by its own merit. Music, it heals the soul and I pray his life turns around for the better.

If some respectful Korean organisation opens a bank account. I think millions people in the world will donate to change his life!

I'm really a FAN on him ..

you maybe made us cry , but those tears are the signs of our expressing that we are happy for you though your a loner , you fight for your future , you never give up .. people are very very proud on you .. keep up the good job. !

thanks for inspiring everyone ..

Choi Sung Bong has been in two major car accidents when he was young, and since he couldn't afford the payment then, he left the hospital. Now he is still undergoing treatment in hospital to make up for that. Each time he visitied, he sang opera to the fellow patients and he has been on the newspaper for that some years ago. God Bless

Lyrics: In my imagination I see a fair world, Everyone lives in peace and in honesty there. I dream of souls that are always free, Like the clouds that fly, Full of humanity in the depths of the soul. In my imagination I see a bright world, Even the night is less dark there. I dream of souls that are? always free, Like clouds that fly. In my imagination there exists a warm wind, That breathes on the cities, like a friend. I dream of souls that are always free, ...

this one's really amazing, same as with paul potts and susan boyle of Britain (try watching them too) they all have in common, unexpected but incredible amazing talents, they are all gifted. God is really equal loving us.. superb..

Beautiful Voice, Beautiful Male Singer

2011-08-09T03:55:00.001+08:00

Hope this song can brighten up your day.

Greatest Marriage Proposal EVER!!!

2011-08-01T17:23:00.000+08:00

Comments:

so cute <3
tjsm143 13 minutes ago

Thank you that’s so nice to watch something positive like that these Days!

Best wishes from Switzerland!

AnnickCC 15 minutes ago

wow... high five for originality :D
Ah19934 28 minutes ago

I thought it was super cute that she could tell it was her boyfriend as soon as he started talking :]
sarahlamppost 32 minutes ago

That was beautiful!
Hehechea 40 minutes ago

omg ! i love this video :)
Mafiachiqkone 56 minutes ago

I cried like a bitch, this was gorgeous!
RicaDominicana 1 hour ago

umh ok that was a cool proposal i will say.

but can we watch the movies now???????
jackal1001 1 hour ago

rare guy! <3
MissRizG 1 hour ago

SO SWEET!!!!!!!
MissRizG 1 hour ago

this was uploaded on may 16th .. and on the same day i proposed my best friend (girl) got rejected though :( .. .. and i didnt even know that when i was so sad.. somewhere in the world was happy like never!! i feel very happy for matt and ginny , i hope i will get "my ginny" someday ahead in the future.. on a may 16th .. in some year
harry140813 1 hour ago 2

girls stop trying to be impressed into marriage.. its gross.. not to mention false.
ihfppl 1 hour ago

omg that was soooo sweet. love it.
MizzNana112 1 hour ago
This has been flagged as spam show
BV10707 2 hours ago
Comment removed
BV10707 2 hours ago

CONGRATS !
itsracheel 2 hours ago

What is the song that plays in the end?
RosanaLobs 2 hours ago

@RosanaLobs Lets get married - Jagged Edge

jigga599 1 hour ago

WOW! Thisis the best wedding proposal ever in the history of wedding proposals. There's really no point in trying to think of a better one and for all us guys out there but to just get on one knee wherever and just pop the question. This guy Matt planned the best and greatest wedding proposal ever but he spent all this time and energy that there's no way he can top this and plan his honeymoon better than this lol. Great job Matt and God Bless both of you in your life long marriage :)
Dec2three198five33 2 hours ago

Congrats to both of you! Ginny your a lucky woman, hope i find my "matt" someday :) p.s. whats the song that plays in this video?
tans90 2 hours ago

He should start planning anniversary ideas
XitemeM 2 hours ago

They will be divorced in 2 yrs !

LOSERS!
mcbloomin 2 hours ago

the black guy in the back just wants his fucking movie LOL

stallionspride 2 hours ago 2

The first I've seen is right after church.
tylus101 2 hours ago

What a real pimp! this guy is a creative genius!! wit a twisted mix of hip hop haha.. gotta love this!
e1krimez87 2 hours ago

ke buena onda, que buena sorpresa, todos por un momento querriamos algo asi :)
alexgrungelee 2 hours ago

I want this.
Dawk20 3 hours ago

Yes, this is not the best, but is the sweetest moment for matt and ginny, this is the best start for them, and wish everything will be better and better. You both are the best in your own way!
louiss168 3 hours ago 3

THEN ALL OF A SUDDEN...hip hop music. X^p
sudynim 3 hours ago

holly crap wen i get married i want him 2 do this
Susan5nah 3 hours ago

Hopefully when its my turn and I do this no one will remember this.
TheTornadoStrikes 3 hours ago

those poor people who just wanted to watch the movie
theundersudy 3 hours ago 2

Aw. I was on the edge of my seat when you were on the way to the movie theater. BEST BEST BEST proposal hands down. God bless. (:
ULTiMATESYNCERE 3 hours ago

The things men will do for some pussy...
razorhanny 3 hours ago

@razorhanny exactly. It really isn't that important.

CMcFreeze 2 hours ago

That guy is the fucking man!
omgshesdead 3 hours ago

how much did u pay for that?
Cesartripe0 3 hours ago

the black guy in the background when they are hugging and stuff is just like - what the fuck is going on here i came to watch the hangover!
Maadsnake 3 hours ago 9

Real cool. Now there are gonna be copycats wasting my day doing this same thing when I'm at a theater to watch a movie that doesn't suck.
sorijin 3 hours ago

Yeh Boy Wooooooooooo
Waagyu 4 hours ago

lol it was ok i guess

xDarkcynx 4 hours ago

HOLY F*** THTS SO ROMANTIC AND IM ONLY 11 WOW
koolvids09 4 hours ago

Can't wait for part 2 : The Divorce
Magicthename 4 hours ago 19

@Magicthename why'd you have to ruin the magic of this? this is why the world is so hopeless.
oldwarplanes 1 hour ago 3

@oldwarplanes yea i hope everything goes well for them but thats a hilarious comment. made me laugh after i cried like a school girl bitch
FinFags 29 minutes ago

@Magicthename lol this was a really great idea and i thought it was really nice of him but that comment is quite hilarious
FinFags 30 minutes ago

i'm a straight guy, but my eyes went teary while I was watching the trailer part
flydanieltv 4 hours ago

i hate being single :(
aussiery 4 hours ago 9

awww...that was just the sweetest thing! congratulations you two! talk about doing it the right way.

sweet808bebot 4 hours ago

ok that was a cool proposal but did she end up watching that movie???
UrFavouriteTroll 4 hours ago

LOVE IT!!!!!!!!
niki2717 4 hours ago

wooo so sweet *.*

idknow2012 4 hours ago
This has been flagged as spam show
MyPoem4u 4 hours ago

PS... don't pay attention to the naysayers and negative opinions of others. Simple: JEALOUS!! Congrats again
COGICHolyGhostwitnes 4 hours ago

can you guys sit down so i could watch the movie.

Thank you.

Great imagination.

good job
Frijo1 4 hours ago

Sir, this was the greatest... def making it harder for all the young bachlors out here! But, you've given me, a young man, a standard and goal to shoot for!!!! Blessings and best wishes to both of you!
COGICHolyGhostwitnes 4 hours ago

This was awesome, but almost exactly the same as mysteryguitarman's.
carvver 4 hours ago

@carvver Ok I get it. guitarman did this already. Now can everyone stop posting about it?

CMcFreeze 4 hours ago

@CMcFreeze Hey, it's not some conspiracy to annoy you, i was just commenting on the video.
carvver 3 hours ago
This has been flagged as spam show
MyPoem4u 5 hours ago

The universal intro footage is used at the beginning of his video. Now isint that illegal ?? :p

Wedding proposal Gone Bad! FAIL!!!
KUSHALRAHA 5 hours ago

@KUSHALRAHA no actually, It wasn't used for commercial purposes, so STFU ;)
DarthLuke6 5 hours ago 3

@KUSHALRAHA dry.....
Deecimal 4 hours ago

genius!
chinchin05 5 hours ago
This has been flagged as spam show
7xXSE7ENXx7 5 hours ago
This has been flagged as spam show
MyPoem4u 5 hours ago

If I were her, I would speak less and pay more attention to the proposal movie and smile or cry more :P
Hitsugayamegumi 5 hours ago

this guy just made 12 million men mad! lol
wakeup186 5 hours ago

This is the most AWESOMEST marriage porposal EVAR!! XD
Madcat717 5 hours ago

My honey better come up with something this brillant... I LOVE IT!! CONGRATS!!
Selenas101 5 hours ago

is this great escape in stockbridge,ga?
melissa6295 5 hours ago

I think the popcorn bit could have been left out....
mitchamus 5 hours ago

@wgamador

hey you started it son. and your telling me that theres a girl naked in your bed, and your on youtube?

right...
rachelovesyoulots 5 hours ago

yeeeaaaaa boiiiiii!!!1

1337superboy 5 hours ago

It was cute until the AWFUL song they chose after she said yes. Absolutely killed the mood. Otherwise, very awesome
LivyLovesTCR 5 hours ago

Hats off to you Matt! Wishing that you guys keep making each other as happy as you were in the video for the rest of your lives!
shamsulshaikh 5 hours ago

I admit, I cried like a baby lol. Very well done!!
princesslulu1 5 hours ago

Everybody wish for d greatest marriage proposal. ;)
Mrderick32 5 hours ago

Yeah, very nice, whatever...
davidpoiu62 6 hours ago

BRILLIANT!
EvanEatYou 6 hours ago

This actually made me tear up!! This is definitely one of the most unique and adorable proposals I've ever seen or heard of. It's woderful! Best of luck to you both.
ellinachka 6 hours ago

who can out beat this one??? this is epic
hydrofizzful 6 hours ago

soooo sweet, i never cry when watching sad n romantic movies n all but ds really moved me!
hydrofizzful 6 hours ago

@mstenacious1 I see your point. I didn't pay attention to all the Facebook and Twitter stuff before.
ilovecoke23 6 hours ago

matt you're awesome! Ginny there's no way you could have ever said no after that proposal! Congrats :)
IWent2BandCamp 6 hours ago

congrats!
ldeahaddad99 6 hours ago

i jacked off to this ... i'm so emotional right now.
phpfanboi 6 hours ago

5:08 YEAH BOY
dh3684 6 hours ago

Mystery Guitar Man do this before!

But, this is still good! Congrats!
BG4X 7 hours ago

Bravo Sir Good Form :D Good luck yall
digitman117 7 hours ago

Assista LEGENDADO em portugues /watch?v=6WMDcwUAVL4
EuAssistoJustTV 7 hours ago 4

awww this made me cry!! SO SWEET! Congratulations!
cheer7blondie9 7 hours ago

yoh dude i would like to do like this its just great i dont have words to discribe my feelings man love it

mo786sonia 7 hours ago

Wow this is awesome and very inspiring. It inspired me to do something loving and creative for my proposal. God Bless:)
Naeolden 7 hours ago

BEST PROPOSAL EVER-3
RoriSutton 7 hours ago

Very Touching! Good job!
singtoyou52 7 hours ago

That's adorable! :)
nikishah90 7 hours ago

Very original & romantic. Made me teary-eyed.
princesaplastica 7 hours ago

What a D-bag, i mean good for him for coming up with something original but please don't put this shit on youtube. now every bitch in the world thinks her boyfriend/fiance/husband is an asshole because he didn't have a dozen people help him ask her to marry him.
justin7803 7 hours ago

This is by FAR the BEST wedding proposal in history! I was in tears while I watched this. (: She's lucky to have such a sweet guy. Best wishes to them (:
thee1Laura 7 hours ago 60

Wow cant watch this without crying, thats just sick...
Waldquelle187 7 hours ago

this is absolutely adorable...best proposal ever. <3
kaitlynxd9 7 hours ago

at 4:00 it's o fortuna
THEMASSHOW 7 hours ago

AWESOME
Hotty95394 7 hours ago

Soooo adorable and creative! Girl you are so lucky!! Made me cry.
Hockey11VR 8 hours ago

What was the name of the music at 3:15???? And 4:00? Anyone plz?
DreadfulControversy 8 hours ago

@DreadfulControversy The song is made by Michael Scofield - Why the bitch dont fart loud enough to make me go poopie.. its a great song
shinyralle 7 hours ago

@shinyralle Michael Scofield is from Prison Break. Stop being useless for once, but I guess that would be a hard task for you.
DreadfulControversy 7 hours ago

I agree, this is the best proposal ever.
xoxoBadRhymerxoxo 8 hours ago

What was the name of the music at 3:15????
DreadfulControversy 8 hours ago

cutest thing ever<3
michellenicolex 8 hours ago

I love "Is there makeup under my eyes??" TOOOO Cute!!! I'm uber jealous! <3 The best to you both!!!
misskamgam 8 hours ago

I wonder what happened to Fast Five!
ankitojha30101990 8 hours ago

The 2,400ish people who dislike this should be car bombed
11Lemonz 8 hours ago

2,427 people are mad because their proposals werent this good
iowabowhunter96 8 hours ago 94

wow... that's setting the bar HIGH.

ThereseJag 8 hours ago
This has been flagged as spam show
ultrajasonlolx5609 8 hours ago

Bravo.
KlonDikeChick 8 hours ago

:) :) :)
cheerstars1001 8 hours ago

what song is it at 3:48??????
marianalucia1000 8 hours ago

@marianalucia1000 Its Oh Fortuna from the Carmina Burana. Its in latin.
jbecknz 8 hours ago

@jbecknz thanks :D
marianalucia1000 8 hours ago

where is the bed scene???....hell no...i want the complete movie...

hbrabim 8 hours ago

i think i heard some guy scream MAKE LOVE. lolwut.
MushieAndMe 8 hours ago
This has been flagged as spam show
ultrajasonlolx5609 8 hours ago

AWW :']
WannaGoToKorea 8 hours ago

Looking forward to see how original their wedding will be :)
TheMikke 8 hours ago

this is movie is very,very nice!!!!
gogy9598 8 hours ago
This has been flagged as spam show
ultrajasonlolx5609 8 hours ago

I would cry so much.

Awwwww~ <3
kitkattcassy 8 hours ago

The smoothest guy ever....
isurf777 8 hours ago

Best proposal everrrrrrr Ginny is pretty lucky. What a creative fiance.!!!!!! Best wishes for thé couple and you have to upload a video of the wedding!!!
sunsetofnemesis 8 hours ago

So, WONDERFUL, couldn't stop smiling the whole time!!!!!!!

DzzRed 8 hours ago

Carmina Burana was a bad choice...
Koldovader 8 hours ago

She got that tank top at Target.
kitkattcassy 9 hours ago
This has been flagged as spam show
ultrajasonlolx5609 9 hours ago
This has been flagged as spam show
ultrajasonlolx5609 9 hours ago

Are they still together??????????????????
brainwashedserb 9 hours ago

@realmofsilence What's the matter with you? You don't know absolutely nothing about me or my bf! You say I'm shallow haha.. You don't know me at all! So please SHUT UP! You don't have anything else to do than being here judging people? Talk is cheap man! Stop talking nonsences and get a life please..
xxelizabeth24xx 9 hours ago

This is nigger shit
Apoc897 9 hours ago

whats the first song that is played? the one where the guy is asking the father for permission. if someone tells me they pretty much saved my life cause i neeeeed this song
Michkins1 9 hours ago

@Michkins1 I'm pretty sure it's the instrumental version of Marry Me by Train. Great song! :)
KayLikesMuffins 9 hours ago

i hear this song in every epic moment!! what's the song called at 3:46 ?
H0lY3V1L 9 hours ago

That was great. :3
clonecody45 9 hours ago
This has been flagged as spam show
ultrajasonlolx5609 9 hours ago
This has been flagged as spam show
ultrajasonlolx5609 9 hours ago

awww! so friggin sweet!!!!!!
Nit3shade21 9 hours ago

FAKE !
TrollinOnMyFace 9 hours ago

OMG THAT IS AMAZING AND SO SWEET
ILuvMyMusic4569 9 hours ago

love it!!!!!! congrats!!!
missvoncile 9 hours ago

Click on my video to find the truth of where Jennifer Lopez's

song "On The Floor"

Came from and how poor civilians were treated in making of this song and it's origin!

Mindofownz 9 hours ago

she must not like him at all

iAfterShock 9 hours ago

Does she still like it up to the right??

GKEV604 9 hours ago

what song is that. i want to learn it on the guitar please tell me

Michkins1 9 hours ago

fake.

iDeanne 9 hours ago
This has been flagged as spam show
ultrajasonlolx5609 9 hours ago

what a romantic proposal

darell724 9 hours ago
This has been flagged as spam show
ultrajasonlolx5609 9 hours ago

i shag her before this guy
Camuchoide 9 hours ago

CTFxC's was better, sorry.
DAlLYBOOTH 9 hours ago

Yeah.. at the movies... sooo romantic...
TheNoxiousReggie 9 hours ago

how much did it cost for the threatre to play it?
GKEV604 9 hours ago

WOW

GKEV604 9 hours ago

That was fucking awesome.
FeelingAnonymous 9 hours ago

AWHHH<3 THIS SO TOO ADORABLE <3 :3 + CONGRATZ!! 8'D
BestAngelFriends 9 hours ago

@wgamador Lmfao. Alright there, I'm sure that was your intention from the beginning. I'll leave you to what you want to think.
Liight2 9 hours ago

I love the way he set this up, complete with the action sequence and Exorcist-style music. Kudos to you, and good luck with your wedding!
OddballExtreme 9 hours ago

Matt, you're killing us out here man. Topping this is going to be difficult.
wardah0 9 hours ago

SONG AT 3:48 TO 4:35? THAT ODYSSEY MUSIC OR W/E?@!!?
EagleLineProductions 9 hours ago

@EagleLineProductions that's "O Fortuna" i think...
AshiteratsuAka 9 hours ago

that's really cute.
mmmikeyxx 9 hours ago

Be funny if she said no

1MarioTheMartian1 9 hours ago

Awhhhhhhhhhhhh -3
rebekahirish 9 hours ago

Beautiful to watch. Wishing you a long and happy life together!
sandismith2 9 hours ago

INCREDIBLE! Ginny is such a lucky girl to have such a sweet guy like Matt!!!!! Best of luck to you both with everything and have a long, happy life together!
truedancergirl 9 hours ago

was this the one in henry county

treyflyer 9 hours ago

lol aku nk kawin ngn pompuan jrmn
logelamutp 9 hours ago

If I were that woman I would have cried out all the water in my body. This is BEYOND perfect!
juliacarone 9 hours ago

You're such a bamf
3800GTV6 9 hours ago

This makes, the traditional marriage proposal's look like shit. :/
cheoleo2500 9 hours ago

haha that is the best thing i have ever seen!!!!!!! I LOVE THE SLOW MOTION PART!!!
Shiver161 9 hours ago

HOW CUTE !!!

And on my birthdaay :D
Banda2fly 9 hours ago

hahah the black man at 5:08 is so jelous:P
tutut37 10 hours ago

this is absolutely amazing. <3
lemonademouthlovers 10 hours ago

He got laid that night
Dibsing 10 hours ago

HEY EVERY
Saftey4Life1 10 hours ago

"Do you want to marry me?"

- "Shshh, I want to know how the movie ends!!!"
DallasGreen123 10 hours ago

2 years later.... they got divorced

h8stupidppl 10 hours ago

this is the most beautiful couple i have ever seen i wish you all the best what i wonderful way to start your new lives together
vixenchild28 10 hours ago

holy shit thats legit
MrKills12 10 hours ago

did they watch a movie after?
avrgboy 10 hours ago

@mysteryguitarman
avrgboy 10 hours ago

lovely
davetteZR1 10 hours ago
This has been flagged as spam show
thomasne 10 hours ago

God bless you two!

Matt, always look at her as the bride she will always be, even though it's true that she will be your wife. You're a blessed man.
M0ofi32012 10 hours ago

you're so romantic!!! congrats!!! i hope you can stay together for ever!!!!
LauritaVanessa04 10 hours ago

She is so lucky!!!!!
Actionnelll 10 hours ago

I wanna see my f-ing movie.
mckinnonderek 10 hours ago 23

LOL @ black guy 5:37

He's like AWWW HELL NAWW where's my movie!?
lyn18mkw 10 hours ago 56

this is the most thoughtful marriage proposal ever. i would die if someone proposed to me like that. <3
loverdearest11 10 hours ago

ahhhhhhhhhhhhhhhhhhhhhhhhhh so FUCKING CREATIVE ¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡¡ CREATIVE + ROMANTIC = BEST PROPOSAL EVER
juncodelrio15 10 hours ago

anyone knows the first song? the guitar fingerpicking..
thomasne 10 hours ago

@shadowX50 haha It actually took me awhile to figure out what u said
Pandasmash1230 10 hours ago

Didn't Mystery guitar man do this? but this is still awesome. Congrats!
Zxyquz 10 hours ago

Whew! Am I glad I got married 17 years ago! This guy set the bar high! Congrats!

scottb326 10 hours ago

yeee

rwing34 10 hours ago

This guy ruined marriage proposals for men everywhere
jedimastersolid 10 hours ago 4

I really want to know the name of the song in the minute 4:15
javonete96 10 hours ago

@javonete96

O Fortuna - Carmina Burana (Orff)
lizdena 10 hours ago

SO CUTE!
bebexrochelle 10 hours ago

Stop setting such high exceptions for marriage proposals!

Now the rest of is are screwed!!!!!!
NoobWithNegativeKD 10 hours ago

so sweet <3 <3 <3

khanhkute89 10 hours ago

Imagine if she had said no...
nicholasperry56 10 hours ago 2

WOW that is the sweetest marriage proposal I have ever seen!! I wanted to tear up just by watching her being happy!!! ^_^
reneroxx 10 hours ago

:'D
TheSchweetGal 10 hours ago

this is definitely the most creative and thoughtful proposal i've ever seen!
sweetcheekshoney 10 hours ago

Wowwwww super original!! Lovely couple! I hope in the in the wedding show some dances or something like this...happy ever after!!
Nikolitapr 10 hours ago

That's soooo awesome!!!! Congratulations to you both!! May you both have many happy years together!!!
K8tina 10 hours ago

I can only imagine if she left to go to the bathroom during this.
victim21 10 hours ago

cool
weirdpapaya 10 hours ago

Crazy awesome and adorable!
1hugaday 10 hours ago

Thank you, Mr Romantic, now I have to BUST MY FREAKIN ASS whenever I'm going to propose. DAMN IT
gorgurus 10 hours ago

no mames... que original... mmm haber si la aplico jejejjeje
edermio 10 hours ago

The man!

unknownrafe 10 hours ago
This has been flagged as spam show
ultilink3 10 hours ago

DAAYUM dats awesome how the hell did he do that?
TheTempestGames 11 hours ago

the dude at the enddd is wearing a ramones shirt! xD
XoBeAtLeBaBe101 11 hours ago

can someone plz tell me the name of the song between 3:47 and 4:38
ultrajasonlolx5609 11 hours ago

@ultrajasonlolx5609 la fortuna
jonpaul784 11 hours ago

cool vid. The awkward moment when she says no... Anyone on this site has an opportunity to recieve 50% or more off at local sales and make money aswell. No finance details needed. Click the link if your interested, and dont click it if your not. Simple. phillnz.thecustomeradvantage. com

nrlrugbyleague 11 hours ago

esto si es amor + babillas = amor eterno :')
toroyaris 11 hours ago

guys, now you know how to do it,

dont dissapoint us, sincerly,

all single women

jj, though this is amazing, if she loves u she wont care wat u do (mostly)
Jcrparamore 11 hours ago

yo thay was gay styll
JAAATTIII 11 hours ago

@realmofsilence deeeer god I was saying that as a joke.
mvaldezdz 11 hours ago

Aw, that's precieuse... T_T :D

DeathNoteOwnerTooBe 11 hours ago

@mikerowaves

i watched that video and honestly yes it has a better quality video but this one was alot better
TheArtObsessed 11 hours ago
This has been flagged as spam show
MyPoem4u 11 hours ago

another fake marriage proposal viral video? ...
exam 11 hours ago

Can we get this off the main youtube screen please? It's taking up too much of my viewing space.
scientolofag 11 hours ago

What a story to tell the kids and grandkids, it will forever be in cyber space for them to watch
angeluise1971 11 hours ago 3

@patbull..jagged edge-lets get married
jboogiemomma23 11 hours ago

@jboogiemomma23

WOW!! Thank you so much, wish you have a nice day!!! *dance*
PatBull76 11 hours ago

Copied mysteryguitarman :/
DjDannyTV 11 hours ago 4
This has been flagged as spam show
MyPoem4u 11 hours ago

So cute! Congratulations to you both!
vdacruz 11 hours ago

@vdacruz touching i give it that i mean that was amazing
TheSoltrain2011 11 hours ago

@TheSoltrain2011 yes.. touching is a better choice of words.. sorry I never made a comment and didn't think people actually read them lol
vdacruz 11 hours ago

@vdacruz brought a tear to my eye to see her reaction i do wish them well for there future
TheSoltrain2011 10 hours ago

thats pretty good!
MrShakDaddy 11 hours ago

@goboenomo What I meant by 'Alpha' was that you tried to seem like 'Dude, I get bitches on the reg man, they don't deserve this'.

If he didn't really love her as much as he showed in this, I would 100% agree with your first comment, that WOULD be too much work just for a chick that he DIDN'T love.

Sure it's a dick move for him to do that in some ways, but in other ways it's the 'Greatest Marriage Proposal EVER!!!'.
iProfessorOAK 11 hours ago

This is the most sweetest thing anyone has done that I've ever seen. She is such a lucky girl. Can u purpose to me too? Just so I can feel lucky like that? Jk. But bravo that's so sweet! Your vid is one of the best I've seen on here for romance I give you two thumbs up from me, my husband and my five kids. Congrats and live life before you have kids cause I know I didn't. Lol but wow still can't get over it. Can you guys do that for other people too? Not the same thing Like a movie theatre but
wendyyaj85 11 hours ago
This has been flagged as spam show
hpbjkr 11 hours ago
This has been flagged as spam show
MyPoem4u 11 hours ago

cutest couple ever! congratulations! :)

xoxo
platinumpinkice 11 hours ago

who sings the last song and what´s the name of it?
PatBull76 11 hours ago

This made me cold, and shiver, the good kind :) the ones that give you goosebumps :)
dudenoway96 11 hours ago

I but some of the people there we're like yeah good for you now shut the f@#k Up
kindaintheway 11 hours ago

lol the people watching the movie was probably like wtf is this... can i just watch my movie now.
dnnsdoable 11 hours ago

She was pregnant and the Father forced the poor lad... (Only kiddin')

That was great.. Even bought a tear to my eye.
Beatlesruleok 11 hours ago
This has been flagged as spam show
MyPoem4u 11 hours ago

Austin Linegar how r u?
Delta9rome 11 hours ago

DO or DIE
Delta9rome 11 hours ago

I must admit, out of the majority of these I have seen, this is the cutest, most unique one yet, Congrats :)
Zirus101 11 hours ago

what is the of song at the end? it´s fantastic...
PatBull76 11 hours ago

I love it! AWESOME!
martinimix79 11 hours ago

what a wanker.. and marriage is for the crazies!!!
MrJoshuaBolster 11 hours ago

that fiasco must hav ruined so many ppls night
DrChitta 11 hours ago

congrats to you guys! ginny you are such a lucky girl =)

kyouyanagi 11 hours ago

The bar on marriage proposals has officially been raised!
Kuorosh1 12 hours ago 47

@Kuorosh1 Than I guess we're playing limbo!
Hobble 9 hours ago

bravo my ass
FatPPlNeverMakeIt 12 hours ago
This has been flagged as spam show
MyPoem4u 12 hours ago

awww he is the sweetest person everr
rachelxoxo1000 12 hours ago

He got laid that night..
FuckTheSystsem 12 hours ago
This has been flagged as spam show
aacard01 12 hours ago

wonderful
aacard01 12 hours ago

if i was there i woulda kicked the guys ass for not lettting me watch my damn movie
damzeni1 12 hours ago

@damzeni1 you wouldn't have been there since the theater was filled with only their friends and family. I guess he's 'saved'
JonelleJNowak 12 hours ago

what if she was at a movie with someone she was cheating with
sinanyongacoglu 12 hours ago

how can she fucking say NO ?
Yod14Gaming 12 hours ago
This has been flagged as spam show
MyPoem4u 12 hours ago

2421 people's marriage proposal were rejected.
madhurpatel 12 hours ago 32

cuteeeee<3<3 she was sooo nervous... omg
CrazyTopfan 12 hours ago
This has been flagged as spam show
Yod14Gaming 12 hours ago

so who were all those people in the theater?
xxXDCXxxx 12 hours ago

@xxXDCXxxx nvm
xxXDCXxxx 12 hours ago

congrats
rubigal1 12 hours ago

ohhh they are so in love
rubigal1 12 hours ago

Every single girls dream inih?
haznii 12 hours ago

if she had say no, this would be called. "useless marriage proposal ever."
juanparty 12 hours ago

@juanparty congratulations Matt and Ginny.
juanparty 12 hours ago
Comment removed
JonelleJNowak 12 hours ago

cutest thing i've ever seen!!!! <3
paigeliviseth 12 hours ago

AWE <3
X3NevermoreX3 12 hours ago
Comment removed
JonelleJNowak 12 hours ago

And so they broke up a year later.

also lol sethrogan
kingbooforums 12 hours ago

You guys are adorable!
C1719 12 hours ago

This is cute but I have to say CTFxC has the best proposal!
gaarasrulestheworld 12 hours ago

This sucks
slabofmeatonface 12 hours ago

Wow! Nicely done!

GKEV604 12 hours ago

Thank you very much for sharing your special occasion. I enjoyed it very much and wish you both the best.
kank468 12 hours ago

This guy is my new hero!
HoveringDeath 12 hours ago

Typical American vomit.
jpgee19 12 hours ago

alilarter8 = you are a asshole. be happy for someone else. you really think you'd be mad that you had to spend 5 minutes watching a young couple proposing? what a sad life you must live...try relaxing and enjoy yourself...bet you have never and will never get married...PATHETIC WASTE OF SPACE
tomwadsworth25 12 hours ago

Beautiful beginning to a marriage to be filled with love. He surely loves you.
keeganob126 12 hours ago

This is AWESOME !!!!!!!!!!!!
mathGaud 12 hours ago

Lol, fail at 4:20 <-------- No pun intended pot heads, just a coincidence.
skepttix 12 hours ago

2418 people are fucking jealous!! may be they are not lucky enough to get married!!
ethanbd 12 hours ago

@ethanbd SERIOUSLY!!!!!
MsDarkrosebud 12 hours ago

Aaaawwww! :)
comeonego 12 hours ago

Omg that guy is soo sweet .
FrOotLooPs1O1 12 hours ago

what the music at 3:47 ???
anphux 12 hours ago

@anphux Carmina Burana ;)
Mejjcikeh 12 hours ago

@anphux O Fortuna.
rambammer2000 11 hours ago

@rambammer2000 how wuld i now
Delta9rome 11 hours ago

that was actually the best thing ever man
RXJ7 12 hours ago

SO LUCKY!!!!! I want that guy!! :))
Hellendeppsptfan 13 hours ago

@Hellendeppsptfan fuck u
jeffvin4 12 hours ago

@jeffvin4 Why??
Hellendeppsptfan 2 hours ago

oh wow who the fuck cares? Worst marriage proposal ever. ( and no im not jealous)
jeffvin4 13 hours ago

2417 people are pissed their proposals will never be as good.
JAWDAYFuddles 13 hours ago

jagged edge was the cherry on top
lk0micho 13 hours ago

lol, what if she said no...
TheDJBeets 13 hours ago 52

@TheDJBeets thats what the sequel is for :D
MagemanE5 13 hours ago

@TheDJBeets >.>''
Comicios 11 hours ago

The best proposal I've seen, and I've looked! Well done!
Ritercrazy 13 hours ago

BY FAR, THE BEST PROPOSAL I'VE EVER SEEN :)
HeckYessRachel 13 hours ago

2,417 people hate life and will never get married
Dasman86 13 hours ago

maybe is not the first and most original, but has some extra points...

-her reaction of :O when the trailer is showing

-the romantic kinda feeling of the begining plus comedy that follows and more xD
JuStViCtoR 13 hours ago 20

Absolutly awsome... :)

youaintshit77 13 hours ago

AMAZING
blightboy1 13 hours ago

LOSERS

horsemania1 13 hours ago

This is just great <3
MsRudeboy55 13 hours ago
This has been flagged as spam show
tahkis18 13 hours ago
This has been flagged as spam show
MyPoem4u 13 hours ago

That is definitely amazing!
Tori4Lif3 13 hours ago
This has been flagged as spam show
MyPoem4u 13 hours ago

That was really cool!!!!
OhanGeorge 13 hours ago

You certainly did make the movies jealous- along with 105,207 people.

Wish you all the best!! <3

BTW 2, 416 people are overly jealous and probably had their proposals by text.

<3 <3
DreamHope11 13 hours ago
This has been flagged as spam show
MyPoem4u 13 hours ago

This was the sweetest thing I have ever seen, but you know the sad thing? When a guy proposes to me in the future, it will never be as amazing as this one, because this video will stay in the pupils of my eyes.

Good luck Matt and Ginny <3 <3 You're the greatest couple EVER!!!
DreamHope11 13 hours ago

@DreamHope11 , well I think it wouldnt be fair for you guy for you to compare his proposal with this one, its the heart and feeling that he puts in it for you that you should be worried about. not all of us guys have the resources to pull that off. but kudos to the guy it was an awsome proposal.
bqtaspr 13 hours ago

Good one Matt, I wish the very best in your marriage..
bqtaspr 13 hours ago

I bet they had an extra 5-second clip in case she said "no," that simply went, "BOOM. Directed by M. Night Shyamalan."
VinylCyril 13 hours ago
This has been flagged as spam show
MyPoem4u 13 hours ago

nice..you scored some serious points with that bro. good luck on your marriage. This will be cool to share with your kids some day!!
baucomrj 13 hours ago

mnaahh, ever lame
extremetothemax86 13 hours ago

I was so expecting her to say NO!

Damn it.
UnexptedB 13 hours ago

like this KtdcqwUbuyY
kartmeraman 13 hours ago

this guy is boss
THEcomcastmaster 13 hours ago

Esto ya si hizo en España, bonito PLAGIO
kartmeraman 13 hours ago

good up until the jagged edge and run dmc song. :/
JeffW1231 13 hours ago

MysteryGuitarMan did a proposal similar to this, but he got Chuck Liddell to be in the movie and the proposal was less epic.
OmgChrissx3 13 hours ago

OMG this is sooo cute!!! :) She's so lucky!!

LittlePrincess2404 13 hours ago

dennis du opfer
newkaynac 14 hours ago

wow!! the amount of work he did!! It was beautiful! ....but how did he get the cinema to let him?! :P
KerriThornton 14 hours ago

hehe...pretty innovative...got to give credit ....awesome!!!
rebelx4life 14 hours ago

That's pretty epic XD
AzureDarkGod 14 hours ago

cuuuuute
fmsjcmom 14 hours ago

Great!!
lluis1969 14 hours ago

That IS the greatest proposal ever :) Lots of luck in your marriage!
xxxPurpleSkullxxx 14 hours ago

MGM was first.
deville487 14 hours ago

This was WAY better than Fast & Furious 5...
IlkaZapata 14 hours ago

woow
Dikadulguun 14 hours ago

That is sooo cute(':
EmziZZZ 14 hours ago

aww !(:

nefariousnatassja 14 hours ago

50% chance it won't last, but good luck.
n91htmare 14 hours ago

@n91htmare 50 % chance you die today, 50 % chance you eat at the restaurant tonight etc .. stupid
qcking666 14 hours ago
This has been flagged as spam show
bamafan6108 14 hours ago

What the fuck is up with those apple spam bots?
pezus 14 hours ago

@holamissmusica lol.. ohhhh... makes sense now why i didnt hear any negative remarks in the background..lol

MrMac415 14 hours ago

@JuStViCtoR thanks!
123yuser 14 hours ago

Awesome proposal, could'nt stop the water works...

guess im human LOL
fvrrljr 14 hours ago

Top marks for originality. Good luck to you both :)
fallyhag 14 hours ago

its very beautifullllllllllllllllllll

CHAWY79 14 hours ago

what's the name of the song at 3:46?
123yuser 14 hours ago

@123yuser o fortuna or o verona dont rememer wich one, is the same that jackass 1 intro movie
JuStViCtoR 14 hours ago
Comment removed
rambammer2000 11 hours ago
Comment removed
123yuser 14 hours ago

i find kinda cute the girl with glases that is in tha theather selling, who is she?? name at least? xD
JuStViCtoR 14 hours ago

aha this is on the news right now :L x
Ashiikax 15 hours ago

Oh Mein Gott IST DAS GEIL!!!!!!!!!!!!!!!!!!!!
privileg 15 hours ago

just broke up with my girl which I loved so much, she broke my heart....and watching this movie proposal makes me feel like shit!!! happy for the couple!!!
djaiseman 15 hours ago

just think what a disapointment and waste of money it would of been if she sayed no OMG
EpicCodClips3 15 hours ago

sooo cute =)

sehdah 15 hours ago

just wonderful....every gye should do this.....
alb378 15 hours ago

nice idea but video soooo long, waaaay too long

they will soon visit a divorce site

DivorcioDirect 15 hours ago

BEST PROPOSAL EVER!!!! That's my kind of marriage proposal :D
94RockerChick 15 hours ago

This is awesome. Im happy for both of you! Watching this makes being single suck lol.
flute1234 15 hours ago
This has been flagged as spam show
MyPoem4u 15 hours ago

THIS IS EPIC!!!!!
philialle4supra 15 hours ago

That was sweet :)
tbsguyguy 15 hours ago

OMG! how sweet is this?! when i saw this, i started to cry :) CONGRATS!
Jinni1706 15 hours ago

ok, leaving apart the fact that marriage is an ill concept in general, this video ain't that bad :) seems like the guy is quiet excited :)
gerailabai 15 hours ago

That was incredibly inspiring
TakeErEz 15 hours ago

someones gettin a bj after that proposal....
kiw321 15 hours ago 4

Just...wow. Congrats, this was hilarious!
TheNexus18 15 hours ago
This has been flagged as spam show
MyPoem4u 15 hours ago

what is the title of the song @3:49???
TheDaryl143 15 hours ago

BUUUUUH! We wan't to watch the movie!
serj88 15 hours ago

This is so sweet, it's funny, and touching. I am very happy for both of you, from Vancouver, BC. Congratulations! :)
JBitzz 15 hours ago
This has been flagged as spam show
MyPoem4u 15 hours ago

fuck the haters! this was AMAZING! congrats you two! I'm sure you'll have a great and long life together :)<3

amyxobrittany 15 hours ago

even though ima guy i cried a bit cuz this is so fucking sick. congratz to them

DEAN66DIME 15 hours ago

whats the "one more surprise"

VirginOfRape 15 hours ago

@VirginOfRape The entire audience were really her friends and family. LOL
TheNexus18 15 hours ago

The YouTube user MysteryGuitarMan did this type of wedding proposal before Matt did. Unfortunately, MysteryGuitarMan isn't getting near the recognition that Matt has, which is a travesty. Imitators shouldn't be given so much credit.
wolfshredder1 15 hours ago 23

@wolfshredder1

jealousy is speaking...

rockee77 13 hours ago

@rockee77 Your definition of jealousy is misinformed.
MisterDyer 13 hours ago

@wolfshredder1 you need to calm down -_- so someone else did something like MysteryGuitarMan why do you give a shit ? are you the one getting married ? no. so shut up and be happy for them :)
ToastTabby 13 hours ago

@ToastTabby he needs to "calm down"? he didn't overreact, he was simply stating that MGM was first.
SpartanW0lf3 8 hours ago
Comment removed
sideshift05 12 hours ago

how the hell is anyone going to top this lol this was awesome congrats!!
danman2626 15 hours ago

@ColdeyLive Looooool!!

Good one.
mrcritic1 15 hours ago

i love this soo much the worlds best marriage proposal...this so beautiful...im so happy for you guys i hope you have a long life of happiness!!
altrisha1 15 hours ago

Great Stuff... Great Minds Think Alike... Check Out "Purple Honey" on Youtube....

thinkcupid 15 hours ago
This has been flagged as spam show
MyPoem4u 15 hours ago

@kendract88 Maybe you cant find the "right man" because you suck? Personalty of a dead fly?

Ever thought of that? Not likely.

You probably think you're gods gift to man.
mrcritic1 15 hours ago 2

@mrcritic1 Judging by your comment you must feel the same way about yourself. But thank you for the compliment...I didn't say it, you did.
kendract88 15 hours ago

in tears :'-)
randomrelly 15 hours ago

TOO EPIC!!!
altrisha1 15 hours ago

Lol, I would probably die of embarrassment if this happened to me. A word of advice to guys who might be watching this: don't worry if you'd never be up for something like this. Not all girls appreciate grand gestures. Keeping it simple and intimate could be better.
KittyToKaren 15 hours ago

@Kizak6 I wouldnt expect that... that's just a reminder to somebody who think they do
btiarra 15 hours ago

@SmilingAlot MysteryGuitarMan did the movie proposal first, but Mattandginny was way better. Only thing cool about MGM was the proposal and Chuck Liddell. Matt had Ginny's dad and he made her cry.
tclark108 15 hours ago
This has been flagged as spam show
MyPoem4u 15 hours ago

12 million hits!!!!! what an amazing proposal
MONERN76 15 hours ago

wow.. that's awesome!!

haters gonna hate..
DisruptableGrandson 15 hours ago
This has been flagged as spam show
btiarra 15 hours ago

@btiarra

You're on a video with over 12 million views. How many of us, do you think, DO know your situation?
Kizak6 15 hours ago 2

wow thats one lucky girl
Jmacsexy 15 hours ago 2

I thought this video was downright adorable. I mean Matt did a great job and I think its wonderful that he felt the need to ask her fathers permission. How many guys would even do that? I'm so happy for you Matt & Ginny; May your life be full of blessings and joy. And may you have a wonderful life together. Congratulations!
ArtemisUrameshi 15 hours ago

@ArtemisUrameshi Yeah, how many guys have the resources to do that? Give me a break, and get over yourself. Seriously. I could just as easily ask that same question about girls. How many girls would even go that far to please a guy (not necessarily regarding wedding proposals)?
batterymet 15 hours ago 34

can some1 tell me the artist+single by the end of the song, i really like it, but i duno who sings^^. thanks.

Btw gz bro.
mdgysbl 13 hours ago

@mdgysbl its lets get married remix by jagged edge
ilyxchanel 13 hours ago

thanks man, youre great.
mdgysbl 13 hours ago

@mdgysbl

It's Jagged Edge - Let's Get Married. :-D
Lycheaa 11 hours ago

2411 people disliked to feel better, because they know they'll never get maried

This is beautiful, real love :)
0003Cat3000 15 hours ago 2

When does this movie come out?
KTWON1 16 hours ago 2

Awww... <3 <3 <3 This one made me teary-eyed. If I were the girl, I would have collapsed in my seat. This is just soooo romantic.

Keep the love alive even after the wedding!
zelpish 16 hours ago

génial mais alors génial romantisme pas mort ca c est une demande
surcouf169 16 hours ago

omg this was too addorable fuk the haters. that was romantic!
iMTOOGRiMEY 16 hours ago

I'm still fapping.

DipzG 16 hours ago

Why the hell is every1 crying while watching this o_o?
Keepin1tReal1 16 hours ago

2411 people have never been in love!
xxAMILLIONARExx 16 hours ago

2411 people had their partners leave them at the chapple
joelbailey23 16 hours ago

good thing i didnt do my eyemakeup yet :.)

Starsofneon 16 hours ago

How sweet
mndhemphill 16 hours ago

Amazing video!! Wishing you both well!!
c4mbl 16 hours ago

theres something wrong with 2410 people, how in the world could u dislike this
driftmcvey19 16 hours ago

Booooooooooooooriiiiiiiiiiiiiing.
Cassandre1986 16 hours ago

@Cassandre1986 Then you obviously don't deserve ti get married. It's very sweet and romantic and if you don't like it, then most probably you don''t have any feelings. How would you feel if someone special did this to you? Would you say it in their face that it's boring? Or thoughtless? Or lame? I KNOW I WOULDNT.
alilarter8 16 hours ago

@alilarter8 I would get mad if somebody makes me pay to watch that. I find it very selfish. People in the theatre have paid their place to watch a movie, and I am sure they do not want to be interrupted by some unknown couple getting married.

Plus, it is boring to watch.
Cassandre1986 12 hours ago

@Cassandre1986 Um, excuse me. You must be a pretty unhappy, b*tchy person. There is nothing wrong with waiting and taking, what, 2 EFFING minutes of your time to let these two people have a little moment. I thought it was amazingly sweet. I would LOVE it if my boyfriend did that for me. I feel sorry for your man....
MsDarkrosebud 12 hours ago

@Cassandre1986 the people in the theatre were all of her friends and family... she didn't realize it til the lights went up.... don't be so cynical and pessimistic. Calm down... read the second to last paragraph at this site: well i can't post the site, but if you go to thesun . co. uk and search "Dramatic movie marriage proposal goes viral" in their search bar, you'll see it.
JonelleJNowak 12 hours ago

En el amor todo se vale
homlac1 16 hours ago

The Universal intro made it look like the actual movie more than a trailer. Still a brilliant idea nontheless.
XFS540 16 hours ago

I cried. So, ver, sweet and touching :') Congrats you guys <3
alilarter8 16 hours ago

Awesome
tommytankvideo 16 hours ago

@kickermcdogg All I have to say is maybe you haven't found the right kinds of girls, I asked my husband to marry me while we were at a street fair drinking, I think part of it is that guys like to have the control.
beesting83 16 hours ago

where were the special effects???? there shoulda been explosions of love, and slow motion love bullets!!
GRIZZ2008 16 hours ago
This comment has received too many negative votes show
islandsylph 16 hours ago

You made her watch Fast Five? That must have put the moods down.
anunfittingname2 16 hours ago

awsome!

from bagdad with love!

wish you a happy life!
08jafar 16 hours ago

Just restored my faith in humanity! -Thanks! ☺♥☺
cooneyfriday 16 hours ago 2

thats freakin awesome!!!!!
Sebbz86 16 hours ago

THIS IS AMAZING!
TTTrixie 16 hours ago

Stole my idea :)

I uploaded on the 1st of March :)

Made a clip for a song "Running to You through the city".
dimka2hot4u 16 hours ago

@dimka2hot4u watch?v=tH2wv5HY3Y0
dimka2hot4u 16 hours ago

Not sure how to create a hyper link with my video but copy and paste in search bar

Joe's proposal to Alexis

2008joealexis 16 hours ago

Matt, you make the rest of us men look TERRIBLE! LOL, This was awesome, I pray that Jesus is the center of your marriage and that you always keep surprising your future wife! Good job man!!!!
rlxrandall 16 hours ago 2

This has been done before. Search for glomer8888 on youtube. He made something like this in 2008. Still very sweet though. Congrats to you both.
pinayperfection 16 hours ago

SECOND BEST PROPOSAL EVER!! I did the same thing three years ago. I just never uploaded the live version as I proposed to her while our family watched. youtube (Joe's proposal to alexis)
2008joealexis 16 hours ago

People are getting WAY too deep on this video. It's a marriage proposal not a sexism debate!

Video is beautiful, congratulations!
kathrynlanelove 16 hours ago

was there any outtakes of strangers in the theater shouting " GET ON WITH IT !! we're trying to watch a movie here GEEZ ! "
iluvmypet 16 hours ago

How cuuute!!! I told my boyfriend he has to live up to this video. :P So beautiful! Good luck with your future together! :)
frecklemonster20 16 hours ago

@realmofsilence Well, the reason why women don't do things is because those are the stadards society have placed on us. Being an indepented woman still isn't a hundred procent accepted, we are never really encouraged to take initiative.
millie1235 17 hours ago

@realmofsilence It's not about expectations; I assure you that this woman had no idea that her boyfriend would do this for her. It's a guy's choice, not obligation, to do what "he wants to do" for his girlfriend. If you want a someone badly, you go out of your way for them. And rest assured, there are women who do much for their men, however, it's only conventional for a man to propose. In my opinion, dignifiedmen decide when it's time to marry and make the initiative.
Zahra1 17 hours ago

Like a fucking bastard boss.
Logadc 17 hours ago

This is so sweet...Congrats to the both of them....
SavChaseAuthor 17 hours ago

That was awesome... and loved her faceial expressions... not many men ask the fathers permission anymore.. I wish you two the BEST of luck and many many years of happiness... Good Job Matt... now watch you started a trend and all guys will want to do it that way bahahaha
superniki36 17 hours ago

this reminds me of a song by children of bodom ... was it worth it ?? .... :P
sykhophaunt7 17 hours ago

ooouuuhhh, so sweeeet ! :D I love it <3
Gertiiee3 17 hours ago

This one beats mine. One time a guy had me use my talents as a mime (see vids) to proposal to his fiancée. He had me perform as a mime on the street, got me to use him & his girl in a wedding skit (she had no idea and just went with it). I played the pastor and "mime married" them in front of all the spectators. I had the real ring and flowers and gave it to her near the end. Once she realized it wasn't just a skit she FREAKED !
ETtheMime 17 hours ago

More views on this than mystery guitarman's proposal and its been out longer so it must be a copy.
MsJeffk1 17 hours ago

@MsJeffk1 I know :( MGM did some amazing and epic trailer and her girlfriend was soo happy!! he neded more credit than this one...
anaalfaro 9 hours ago

BORING MOVIE.
god604 17 hours ago

2408 people need to get laid
AlexHRocknroll 17 hours ago

nothing is original anymore, but they still made it very special
superpowergod 17 hours ago

Wait...soo there was no movie?

Luupz 17 hours ago 2

@Luupz

I would have asked for a refund, what a shit movie!
lacedboxa 17 hours ago

@Luupz OH OH wait just discovered the "Show more" button.
Luupz 17 hours ago

@kendract88 Good job contradicting your own post. But, I'll address your point anyway. If women want those "nice things," then they should also be giving those "nice things" in return, especially if you're going to be preaching about equal treatment. You can't have it just one way; otherwise, you're adhering to double standard logic, which in turn, makes your original point completely flawed.
realmofsilence 17 hours ago

@realmofsilence I should commend you for misreading all of my previous posts. I'm not going to dignify you with any more responses. :) For the record, I'm the one giving and never receiving.
kendract88 17 hours ago

@kendract88 I didn't misread any of your posts. You just couldn't properly argue your point, as it was already extremely flawed. So, of course, you act as if that's somehow my fault. Nice.
realmofsilence 17 hours ago

@realmofsilence I argued my points just fine, you chose to interpret them your way is all. That's cool though, whatever floats your boat.
kendract88 17 hours ago

@kendract88 Oh, yes, of course, I magically chose to interpret them my own way. Just keep running in circles. 'Round and 'round you go! By the way, I thought you weren't going to dignify me with any more responses? A change of heart already?
realmofsilence 17 hours ago

@realmofsilence Magic has nothing to do with it. And I lied. I'm enjoying your responses. It's quite amusing, please, go on.
kendract88 17 hours ago

someday!!!!
chuziechinkz 17 hours ago

this is sooo sweet. i have instantly become a fan of their love team. ^_^
iamqwertyprincess 17 hours ago

as we 16 year old dress flashy and call everything gay i admit this is quit good.totaly a good way to satisfy woman.
MrThereiscake 17 hours ago

OMG this is so damn cute!
Wiggyify 17 hours ago

This was the sweetest thing I have ever seen... I almost cried watching it. Congratulation you two! :) Everyone deserves to have a relationship like the one you two share :)
Taylorcn171 17 hours ago

Awesome! What a lucky girl! Congratulations!!
imsuprmom7 17 hours ago

nice creative idea for something that's supposed to be special, but putting it on the internet for view counts cheapens the whole thing
uclabruin07 17 hours ago

Pekneee

MrSilvo72 17 hours ago
Comment removed
OnlyQueeg 17 hours ago

I cried and i loved it, the only thing i didn't like was the final song...
andypavon 17 hours ago

THIS IS NOT ORIGINAL.

mikerowaves 17 hours ago

@mikerowaves But original.
OnlyQueeg 17 hours ago

@OnlyQueeg So something that was done several times before is the real definition of original?
mikerowaves 17 hours ago

@mikerowaves then not fake.
OnlyQueeg 17 hours ago

too sweet :o) loved it! congrats to the both of you
cherNstephen 17 hours ago

quite some comparisons with How I met your mother s05ep23 the wedding bride
Gaucho09vvc 17 hours ago

wow i can't believe i actually cried after watching this! congrats! :)
kevtom 18 hours ago

downvote for the idea being blatantly ripped off from MGM's vid
acbalingit 18 hours ago

2404 people have never really loved someone
madheadramzy 18 hours ago

FELICIDADES AMIGO-...... he estado algo triste, pero por cosas como esta AUN CREO EN EL AMOR.... MUCHAS GRACIAS ¡¡¡¡
licantropo2525 18 hours ago

this would be clever had another youtube video not been posted of someone who did this already.

mikerowaves 18 hours ago

@mikerowaves

what video would this be?
TheArtObsessed 18 hours ago

@TheArtObsessed It's actually in the list to the right under "The BEST movie theater proposal EVER!!!", posted by "andrewmanzano".
mikerowaves 18 hours ago

GO CANUCKS GO!!!!!!!!
myusernameistaken23 18 hours ago
Comment removed
PippaCreativity 18 hours ago

Nice, but you copied MysteryGuitarMan :P
SmilingAlot 18 hours ago 10

@SmilingAlot it is nice, maybe copied but he's made it his own :) and thats all that counts
PippaCreativity 18 hours ago

@PippaCreativity It's actually an exact replica of the other proposal. Just sayin' lol
SmilingAlot 18 hours ago

@SmilingAlot Thank you.
mikerowaves 18 hours ago

man no one can top this.

everyone is using "best marriage proposal ever!" as their captions

but this one takes the cake.

No body else has the right
BluntlyComical 18 hours ago

'sniff' 'sniff' soo touchin 'sniff' 'sniff'
bootybouncersFTW 18 hours ago

God bless u two- Matt and Ginny. U guys make an awesome couple!

cheers n have a good life together!

MrFrankrulz 18 hours ago

Congratulations!!!! I am so happy for yall that was very sweet.
mizudemon 18 hours ago

all you people complaining because men have to always take the initiative, just look at history. It's your own fault. Men always wanted to be superior and be the only one able to get a job. Therefore, you have to pay for everything. Get over it. If you don't like it, then don't date us. And I don't know about the other women on here but I cook and clean for my guy and I don't get crap in return. I put him first always and don't ever get the same in return...THAT'S why I can't find the right man
kendract88 18 hours ago

@kendract88 Ok, so, you're basically admitting that if the guy has the job and has to pay for everything, then the woman doesn't deserve to be treated equally. Got it. Of course, I'm sure you're going to say that's not true, but then you just contradicted your entire post.
realmofsilence 18 hours ago

@realmofsilence Actually that's not what I said. I said that's what you men have expected for so long but now that we want those nice things because it no longer represents weakness, you're all complaining.
kendract88 17 hours ago

looove it.!!!!!!! totally awesome.!
thenikhilkamra 18 hours ago
This has been flagged as spam show
MyPoem4u 18 hours ago

It was a beautiful proposal, it's not about what's expected of men or what women need to do be considered equals...When there is love and respect by both parties you want to give the other person your best. Because they bring out the best in you.
EsmiKC 18 hours ago

his wife is hot
TairyMrHesticles 18 hours ago

now thats cool
TheLordTroy 18 hours ago

what was the "I have one more suprise for you." ?? Anyways, may the future be the best for you guys. :)
MarioxLove64 18 hours ago

@MarioxLove64 the movie theatre was full of her friends and family!
ayethatoneaye 18 hours ago

This is unbelievable! Wonderful, congratulations!!!
marcioferroni 18 hours ago

What a beautiful proposal! Best wishes - you make a wonderful couple!
TheNewAgeGirl 18 hours ago
This has been flagged as spam show
ILoveTouYube 18 hours ago
This has been flagged as spam show
MyPoem4u 18 hours ago

Woow thats nice!

TheDisturbedMan 19 hours ago

how cuuuuuuuuute :3
MRScapatanaa 19 hours ago 2

I love it!! Awesome!! May God Bless your Union.
machellr 19 hours ago

I guess all that counts is that your girl likes what you did for her!! :)))
Jadeslippers 19 hours ago

awww
dannylynnforever 19 hours ago

Why aren't more men like this? Better question, why aren't more women in the kitchen making sammish's and grabbing me a beer?
ColdeyLive 19 hours ago 8

@ColdeyLive cause you're an idiot and clearly don't know how to treat woman ;)
xoxsingingxox 19 hours ago

@xoxsingingxox I'm glad that your a women and nobody respects your opinion :D
ColdeyLive 19 hours ago
This has been flagged as spam show
batterymet 19 hours ago 9
Comment removed
batterymet 19 hours ago

Omg Absolulity MindBlowing !! Lucky Girl ! Congrats xxx
StephanieLaura2010 19 hours ago

i..like..the..trailer!! <3 is it weird that this video made me cry? haahaha
ArynneVengeance 19 hours ago

MGM?

crundlepieofficial 19 hours ago

2401 are jealous girls who didn't have a proposal like this
TheOnlyRealJoker 19 hours ago 4

that's the best proposal!!!.... Congrats to you both! :D

rsts32 19 hours ago

That was funny... but it's AWESOME!!!!!!!!!
Yashwanth1996 19 hours ago

Para cuando el trailer de la primera noche de sexo!!!!!!??????
leydenpsp 19 hours ago

What if she says NO !
AlexTube95 19 hours ago

2,400 ppl thought the dislike like button was the "dis- i -Like" button!!
rudegal2020 19 hours ago 2

@rudegal2020 Not they didn't.
willywalls 19 hours ago

Lol Even if the movie isn't that great - that would totally be worth the price of admission! ;D
AlterEgox5 19 hours ago

This video was awesome!! It brought tears to my eyes very creative and funny too!!! thumbs up!!
shairaglows42 19 hours ago

2400 ppl might be gay or lesbian !!
Pasbara88 19 hours ago

@Pasbara88 no, they're just regular guys who were talked into watching this by someone.
daspolitbuero 19 hours ago

they did file for divorce last week.
daspolitbuero 19 hours ago

das cute...
MissTina993 19 hours ago

I love how he buys popcorn first... xD Lol.
RegenxKaulitz 19 hours ago

BEST EVER!!!
tomashcu60 19 hours ago

pretty blooody awesome mate. he wouldve gotten some sweet arse loving that night.

killallemovermin 19 hours ago

all the girls are like, "jealous" while the guys think "duh".
daspolitbuero 19 hours ago

this has already been done :/ but it's still sweet (:
blogursky 19 hours ago
Comment removed
2lucic 19 hours ago

this guy is EPIC!
Nev4rForgotten 19 hours ago

Matt this was the most brilliant and entertaining proposal I have ever seen!!Ginny has a wonderful guy!
2lucic 19 hours ago

awwee this is so sweet! I can tell you to truely love each other. :) Best of luck you two
5EmilyGirl 19 hours ago

el amor es creativo, jejej muy bien por ellos
HiddenExperience 19 hours ago

YOU ROCK DUDE !

rajaijaz007 19 hours ago

Just amazing!!
tamlynne2101 19 hours ago

What are the name of the songs, where he run and where she say "yes"?
wessleph 19 hours ago

awesome

drniel04 19 hours ago

Awwww!
lalaala12345 19 hours ago

This Rocks,.. Congrats to you both. Fantastic Idea Matt
love4musicnart 20 hours ago

Dude's legendary!

Drtast 20 hours ago

OMG, them apple people are so retarded, all there names like ends in a letter with a number before it, so stupid! all saying thanks with the same code name, dont fall for it people! :D Thumbs up for everyone to see!

Love this love story btw :')
jlo2k9 20 hours ago 2

was this staged?
nas6792 20 hours ago

How did they get the theatre to run this?
hallpriest9 20 hours ago

Congrats you two..... this was very original and I even teared up.....and im a GUY!!
kcs51777 20 hours ago

Great !! all the best for both of you
ndrymix 20 hours ago

didnt know chester benington had it in him
ConorNosThrill 20 hours ago

Matt you are a genius, just wondering now what you will have in store for your wedding! this really made me smile

JaineLV183 20 hours ago

...is that a 'small' popcorn??
NorHuxy 20 hours ago

@mvaldezdz And if you're a girl, you should do something like this as well and stop making the men do all of the work. If you want equal treatment in life, then you have to show it in return.
realmofsilence 20 hours ago 51

@realmofsilence there are women out there who propose to their men. and it's the guys decision to go all out for their girl, no one's forcing him to do so... don't be so freakin' discriminatin....
hard2pleaz 19 hours ago

@hard2pleaz Discriminating? Society has placed standards on men that they have to do these types of things. The man is always having to do everything he can to make the woman feel special. When does the woman do something? Also, there were women bitching in this thread about why more men aren't like this. You see? If anything, THAT'S discrimination. Why the hell is the man always obligated to go to these levels? As I said before, women have such ridiculously high expectations.
realmofsilence 19 hours ago 26

@realmofsilence These are stereotypes that society has taught boys and girls is expected of them since they were born; not every women is screaming for equal rights. If you don't want to be held to these expectations then date a girl who doesn't believe in them.... Although, are you willing to take a girls last name?

kimmietate03 19 hours ago

@kimmietate03 i know right, it makes sense for guys to propose and everything and on the day of marriage we girls give away our names for theirs. ..i guess these "stereotypes" have really just become something of an unspoken rule encouraged on both sexes....like why can't women propose and men give away their names on the wedding day, huh?
wootwoot937 18 hours ago

@wootwoot937 You're both missing the point. Men are always expected to take the initiative. It's not just regarding wedding proposals. Hell, we're expected to pay for everything, open doors, etc. Not to mention that we're the ones who are supposed to ask women on dates and dances. Then later, women complain about "not finding the right guy." Well, if there's a guy you like, then here's an idea: GO ASK HIM OUT YOURSELF. Otherwise, you have no right to complain about "not finding the right guy."
realmofsilence 18 hours ago 69

@realmofsilence They don't find the right guy in clubs. In clubs people are more interested in making out. That's why most of the nowadays girls don't find the right guy, also, they're stupid, they prefer a cold hearted guy than the sweet guys, they reject them, people want too much freedom, with a lot of freedom people can't be loyal and stick where they are. I didn't ask my boyfriend for anything, he did all by himself, and when we started dating, i gave him all of my love and retribution.
andypavon 17 hours ago

@realmofsilence i agree with you.. alot of women expect a man to go to these levels just to do this type of stuff.. then they do nothing in return.. i think it should be equal.. MEN HAVE FEELINGS TO YOU KNOW...
kickermcdogg 19 hours ago 14
This has been flagged as spam show
2lucic 19 hours ago

@mvaldezdz so, hows your love life?
voodoocigam 19 hours ago
This has been flagged as spam show
MyPoem4u 20 hours ago

best proposal that I have ever seen.
drwho269 20 hours ago

Red top is going "Can we play the movie now PLS?"
Cartyy 20 hours ago 34

aren't they going have a lot of extra cash from Youtube!!! CONGRATS!!
MsQuinnyb 20 hours ago

WOW people are so stupid and ignorant ---- i just got engaged and i think this is the cutest thing i have ever seen - each couple is unique and so is their engagement story! clearly yours matches your love for cinema! i, for example, got engaged on a beach, barefoot because that is what my fiance and I are into! best of luck to you and yours on your upcoming marriage!
DSilver117117 20 hours ago

guy in red t-shirt at 5:35 "START THE FUCKIN MOVIE ALREADY". :l
Kyukoji 20 hours ago 3

@btiarra Then, he should dump your ass right away for having such ridiculously high expectations. Women like you deserve nothing but the worst treatment in life. It's unbelievable that you could even say something like that about your own boyfriend just because he doesn't do something like this. What the hell have YOU even done that remotely compares to this?
realmofsilence 20 hours ago

@GDI109 Agreed!
realmofsilence 20 hours ago
This has been flagged as spam show
MyPoem4u 20 hours ago

this is super cool, im gonna do this to my future wife i SWEAR!
thekidwhowantstosing 20 hours ago

Iltasanomat (Y)
MrMirrro96 20 hours ago

@mvaldezdz That guy is right. Please enlighten us on what girls do for guys that even remotely resembles something like this or any grand wedding proposal. Go ahead, I'm waiting....
realmofsilence 20 hours ago

THAT WAS incredible bro....Im about to get engaged.....This was redic!!!!! best one I have ever seen

drwayal 20 hours ago

I cried!!!<3
ToniMariexo87 20 hours ago

How sweet! Congrats :)
PassionDragonFruit 20 hours ago 2

this is the cutest thing ever.. i hope i get proposed to so sweetly one day and not just at a football game or something
badass964 20 hours ago

damn I've been outdone!

seaton125 20 hours ago
This has been flagged as spam show
MyPoem4u 20 hours ago

Thanks keep them comming
bettyruns 20 hours ago

But how was the film?
MrHellothisisme 20 hours ago

2395 people are obivously hidiously jealous & never watched a romantic movie.

this proposal is awesome!!!! <3
banout7 20 hours ago

@DannyIgnite

Alright man I'm sorry.
ninearthify 20 hours ago

Thumbs up if the Carl Orff sequence was your favorite part.
warden1103 20 hours ago

This is the cutest most amazing proposal I have ever seen. Goodluck :)

-3
Aimzybabe1 20 hours ago

Awww! Truly awesome! Wish you the best of luck!
Makubex195 20 hours ago

i wish someone said: SPOILER ALERT, HES GAAAAAAAAY.
danieljkmorrison123 20 hours ago 2

When he hugged his to-be father in law, you can see tears in his eyes. What a fucking good video.

dannyboyinxs 20 hours ago

this is soo awesome dude.. wow.. makin wanna cry...i noe how u feel bro.. jus started dating this girl and we gonna have our second date this weekend but i love her already... cant wait to pull something like this for her
bigseksi1 21 hours ago

I so wanna rip that off! ahaha

hobbles477 21 hours ago

Well this was some self indulgent crap, not sincere at all. Seems like a set-up for youtube 'fame' with that oh so obvious message at the end and website in the description lmao.

CommentFanatic 21 hours ago

Im so jealous of this....I thought I proposed in a cool way !!
latinsatinsoul 21 hours ago

Thats just awesome! I am still laughing from stopping to get popcorn.
kaebug 21 hours ago

You are an amazing man, Matt!! It took great will and an amazing soul to come up with something like this.....UNHEARD OF!!!! This has made it all over the front page of MSN home page. I would not be suprised if you guys end up on national news over this. Makes me Really think I need to step up my game a bit!! Thank you, Thank you and many more thank you's. At this point you have already had over 12.5 million views, it must say something for what you did. Congratulations!
F4flight 21 hours ago

2395 people got left at the alter
chillitsagame 21 hours ago

wats the music in between the vid again?
xxNzw 21 hours ago

so supprise...
hoangvu9688 21 hours ago

I usually hate these things but this was truly the greatest I've ever seen. I wish you both the best of life's luck.
DarkKrush 21 hours ago

marriage is shit! you should live free
sothgunfil 21 hours ago
This has been flagged as spam show
noudzii 21 hours ago

amaaazing !!! luvd it
noudzii 21 hours ago

!!!omg!!! that was perfect.

wow

lucky girl..and guy lol
sam61133 21 hours ago

u callin' this shit the greatest? oh cmon man. there's even more greater proposals than this one. this is crap man
beacruzify 21 hours ago

@beacruzify Obviously you don't realize how much time, effort, and money went into this.
DJsnapp1e 21 hours ago

@DJsnapp1e u can have all the time man, and if it's just money ur talkin' abt here, then i could just give my girlfriend lotsa money then ask her to marry me.
beacruzify 21 hours ago

i find this difficult to masturbate to.
zacmatt8 21 hours ago 4

that is so awsome
ShaolinRyan 21 hours ago

What is the name of the movie they're watching?
babidji 22 hours ago

Start the movie already....
smokejump1 22 hours ago

that is beautifull

SkilZ2GrilZ 22 hours ago

this is the greatest marriage proposal ever!!!
MrAlbatros03 22 hours ago

i don't mean to be that guy but what if she said no
jahvan201 22 hours ago

@jahvan201 LOL AWKS AS

EnhanceWoW 21 hours ago

5:35 that guy in red in the background is thinking enough already...I ain't clapping.
aifusatiluj 22 hours ago

thanks 4 this page I got one!
bellemers 22 hours ago

way to go Matt....
fgalvaobrazil 22 hours ago

imagine the people watching. 'This is one fucking long movie trailer' lol.
flyingemuzZZ 22 hours ago 3

Pfff...The greatest? come on man.. what a disappointment. This is not even a new idea.
mrmojodadog 22 hours ago

PLAY MY MOVIE
HuCkDuCk 22 hours ago
This has been flagged as spam show
kulpreetg 22 hours ago
This has been flagged as spam show
kulpreetg 22 hours ago
This has been flagged as spam show
kulpreetg 22 hours ago
This has been flagged as spam show
kulpreetg 22 hours ago
This has been flagged as spam show
kulpreetg 22 hours ago

very nice idea! so sweeeeettttttttttttttttttttttttttttt

einalem007 22 hours ago

Who saw this in the headlines of MSN? :)
PrincezzLaurenLolz 22 hours ago

#criedlikeababy

jujubagirl 22 hours ago

Is it just me or is that guy's voice sound funny? Maybe it's just his accent.
dailylife100 22 hours ago

Wow!!!! I'm jealous!!! That's sooooo sweeeet!!!!
lucysg88 23 hours ago

Imagine if she woulda said no LOL!
drasent 23 hours ago

@drasent LMAO
truongphan90 22 hours ago

SWEEEEEEEEEEETTTTTTTTT!!!!!!!!!!!!!!!!!! ♥♥♥
keyofdead 23 hours ago

2387 people are just jealous or never have been in love.

This was awesome.
Misstiffanija 23 hours ago 2

Impresionante amigo !!! la mejor pedida de mano que e visto !!! desde menorca !!!! felicidades

dLa0811 23 hours ago

That black dude looked annoyed..
chriscr123 23 hours ago in playlist Trending Videos of the Week (5/20)

thật lãng mạn hihi

hantuyetka 23 hours ago

Thats sweet
7964harry 23 hours ago

Now lets just imagine she just said no.... awkward :/
BoyPaper50 23 hours ago

so cute. i teared up
BeautyScarz 23 hours ago

Every day people get married, but I pray that they make a difference.
rey1940 23 hours ago

This man more than deserved to marry any girls !!
t3eS92 23 hours ago

Congrats dude. You just made every other guy seem super mediocre. :/
kholl7 23 hours ago

holy fuk ginny is bangin'
HeshTatu 23 hours ago

woooooooooooooooow!!!!!
ElisaLoveWestIndies 23 hours ago

oh my goodness..this is the sweetest/cutest thing I have ever seen...congrats!! haha :)
jonassfann09 23 hours ago 2
This has been flagged as spam show
fatjim741 23 hours ago
This has been flagged as spam show
bmaxcey 23 hours ago

I know this is great, but umm what about the movie the people there was gonna watch, I'm sure they were annoyed after a while when a whole bunch of other people came in...
samuellis 23 hours ago

That was to flipping cure..
bmaxcey 23 hours ago

that is probably the cutest thing i've ever seen. you've got a keeper there, lady
Beccabear08 23 hours ago
This has been flagged as spam show
fpvvsford 23 hours ago

this is soooo cute...

mpscats360 23 hours ago
Comment removed
fpvvsford 23 hours ago

awww I wanna get married now!
sheronah101 23 hours ago

the best ;)

prince3argf 23 hours ago

my sister cried after watching this.
sebdlc1234 23 hours ago

Amazing...and the fact that they are playing "Jagged Edge" at the end is too funny.
aziajs 23 hours ago

this is soo nice :) congrats from Hungary! :)
trixy345 23 hours ago

great

guazas69 1 day ago

everything was magically perfect ... until he drove a ford *sigh*
NoBiggieJustMiggie 1 day ago 3

Their 2nd date and they are getting married? WTF?
SaconoWoW 1 day ago

@SaconoWoW He said "Since our 2nd date, Ive always been sayin , we were gna make other movies jealous"

Hence the title of the "fake" movie.. Making The Movies Jealous.. Did u even pay attention? Or were you getting popcorn?
UDpizzaguy1 23 hours ago

@SaconoWoW umm, are you retarted?
Nathanchooper 23 hours ago

Congratulations to you both! Best proposal I've seen. Love from Ireland. Xxx
Netty271 1 day ago

Type in Nick Satt and see funny music videos
TheAlbinoNegro 1 day ago

can I buy the movie rights to this?
silverd20 1 day ago

n'awwwwwwwwwwwwwwwwwwwwwwwwwww
TheLuv2drawanime 1 day ago

so when does this movie come out?
firehill56 1 day ago

ok that was good
r2dan 1 day ago

stupid place to to propose,
bigjake52 1 day ago

& everoyne lse is like 'WOOO congrats! wait what about the movie?"
astrotoadp6 1 day ago 3

Was hoping someone in the back would yell out, "Start the fucking movie..."
tvfilm 1 day ago 12

@tvfilm nah, i was hoping that when he went through that door, the screen would say " to be continued"

ZinXR 22 hours ago

@ChainX k
MisterBinx 1 day ago

@GAMEVIDZ12344 When someone does that for you, its hard to say no.
zGamerXz 1 day ago

lol it would be funnY if she said no
GAMEVIDZ12344 1 day ago

ok that was really good!! im crying :)

karaokegals 1 day ago

totally the best wedding proposal ever!! Congratulations to both of you!! I hope you will always be happy!!:)
ole9898 1 day ago 2

I siincerely hope the strangers were apologized for the delay on the movie!
HamoudyA 1 day ago

gay
sh3rro 1 day ago

The most epic movie trailer I've ever seen. Bringing 3d to a whole new level...
infinity579 1 day ago

AWWWW how romantic :D
pooney4 1 day ago

Awwww soMe :)
deadpool358 1 day ago

the marriage proposal bar just got set higher...
thlin 1 day ago 2

Wow...So yeah...She probably just got engaged to the most amazing person on earth ((:
iluvrimmel 1 day ago

omg so beautiful
MitzuYamazaki 1 day ago

crazy
lfes2k 1 day ago

Привет из России )))

нас поразил ваш ролик )

молодцы !!!! )
VenomRus48 1 day ago

привет из России )) наспоразил ваш ролик )) умнииицыы )))
VenomRus48 1 day ago

i would laugh if she said no! LOL
YourGamingXP 1 day ago

1 week, 12 million views, unbelievable like this movie.. very very nice :-)
suCKRRRRR 1 day ago

This is such a cute way to propose! I also got engaged this year and it feels so great to know who you are going to spend the rest of your life with :)

congrats guys! All the best!
BeautyDivineable 1 day ago

that was incredibly sweet!!!

LayByMySide 1 day ago

So are we going to get to see the wedding night movie when their alone? That's something I'd watch.
SteveTheSpaz 1 day ago

@SteveTheSpaz That Guy Got Mad Sex That Night.
FallenEmpireLegions 1 day ago

cool
cblpop 1 day ago
Comment removed
immaShitDisturber 1 day ago
This has been flagged as spam show
randomuserlfc 1 day ago

CUTE!

TrueStunnah 1 day ago

congrats this was so cool i did almost the same thing i hope to see more check out mine let me know what you think may you both have a long and happy life and congrats one more time GOD BLESS
rickmcinroy 1 day ago

Is this movie coming to theatres in Vancouver??
ismymikeworking 1 day ago

My friend posted it on me and our friends facebook, i love this so much! i wish it was a real movie! yall should be movie stars. i cried when i seen this! good job and you are one of the sweetest guys in the world, you are very blessed darlin..good luck to yall!
Aktippens 1 day ago

thats awesome .. shot bro
rangeo100 1 day ago

shes so cute....lucky he a threw a ring on that ASAP
kiddfabul0u5 1 day ago

So sweet. happiness
ktsduylinh 1 day ago

cute

Ridylan 1 day ago

good thing the world didn't end or this proposal would've been pointless
Izzdan 1 day ago 2

Zzzz...."Nice waste of moneyblahbalh" I think ppl who are going to watch that movie have been told about this proposal thing.
namasterchoma 1 day ago

That was a modern fairytale right there
BeautifulVampire123 1 day ago

WAY AWESOME CONGRATS!!!!!
projecrunway 1 day ago

That is so sweet
xxgwyloxx 1 day ago

As soon as the trailer started playing everyone else in the theater was thinking "This movie's gunna be SHIIIIIITTTT"
forkness9494 1 day ago 16

This is so cute. Happiness to the couple!
akmormongirl4ever 1 day ago

and this video will pay for the wedding, lolol.
HockeyDiane 1 day ago
This has been flagged as spam show
randomuserlfc 1 day ago

The proposal on YouTube, The honeymoon on RedTube!
TheNzCherub 1 day ago 9

fuck that would have been the worst movie to go on a date to.
WildLifeFantastic 1 day ago 11

i was expecting the top comment to be about the canucks
hardyboyztoextreme 1 day ago

shutup with all the "what if she said no comments". Obviously the guy has got to be confident that she is in love with him and that she was going to say yes before he did something like this. Your a fool if you do something like this for a proposal and your not 100% sure if your girlfriend even loves you or would marry you.
karmadtran 1 day ago 5

Can you guys do a vid about how you met and your story together soon??
abender08 1 day ago

love so much this trailer ... unique ... god 4 ur everything ...
chocofilling 1 day ago

12 mill views wow
invisibleyinvincible 1 day ago in playlist Trending Videos of the Week (5/20)

I almost cried that was so sweet good luck to you two<3
samiireaper 1 day ago

Wonderful! Who is this person, 2,380 ?
poweremsa 1 day ago

That is admirable!!! :x
MrHamDzui 1 day ago 3

There are 2,380 jealous movies.
jabrolter15 1 day ago 4

He wins, he get the pussy.
ronz706 1 day ago

@ronz706 grow up much?
CPPA 23 hours ago

Wow, I haven't cried and laughed in a long time, thanks guys!

jairave 1 day ago

lucky girl...:)
blackbelle87 1 day ago
This has been flagged as spam show
EnzoCheLatino 1 day ago
This has been flagged as spam show
Edwany1 1 day ago

Super tierno!!!, que chévere que aún existan ese tipo de detalles!!. Felicidades chicos!!!.
Hivanvv 1 day ago

I hate the two top comments.
EnzoCheLatino 1 day ago 2

i've posted the news in Spanish and will add the youtube link luck. allimimito com
Edwany1 1 day ago
This has been flagged as spam show
Edwany1 1 day ago
Comment removed
Edwany1 1 day ago

Great idea! Awesome execution !!! Perfect!!! I wish my BF would propose that way ;) or along the same lines :p
fashionistakitty 1 day ago

WOW!., I love it!!...So Romantic Man!!..,I've posted the news in Spanish and will add the youtube link luck.
Edwany1 1 day ago

3:47 - 4:38 o fortuna. best part ever
soulzterz 1 day ago

that.is.so.cute.
tjsofele28 1 day ago

that was mind blowing :D
supernijaorangejuice 1 day ago

wow...I`m romantic man, but this idea is the best i ever see...

vexa007 1 day ago 3

Damnnnnn so romatic
frenly74 1 day ago

i thought that someone would go like "what the fuck dude!? i wanna watch my movie!!!" nice btw congrats!
gordishosexy 1 day ago 3

ohmyawd, I wish I can do that to my future wife.
MrCwalkpeter 1 day ago

Damn!!That was interesting
Blankname101 1 day ago 3

He is the most interensting man
MegaDemonlover 1 day ago

it would be so awkward if she said no
JoshWallaceGC 1 day ago 4

Fake and Takei..
MoOtErFiCk1 1 day ago

GO CANUCKS GO!1
ravballer 1 day ago

now that a propsal
animenewbie420 1 day ago

why would someone dislike this

HughsieBoy24 1 day ago in playlist Trending Videos of the Week (5/20)

Im surprised all her girlfriends didnt tell her. :P lol jks. Very well done. Grats.
ShaneyPo0 1 day ago

THAT WAS MY IDEA|

jk congrats!
worldfamous09 1 day ago

NICE
cana2011da 1 day ago

The narration was so bad.

thenewdesignone 1 day ago in playlist Trending Videos of the Week (5/20)
This has been flagged as spam show
liamisocool 1 day ago

This is adorable :)
megbutlerschannel 1 day ago

2 years later.....divorce
pygame 1 day ago

didnt mysteryguitarman do something like this?
HeIIToAll 1 day ago 2

@HeIIToAll yeah and he did it better
MrFunnyEd 1 day ago

I bet the 2,377 dislikes were from film directors... They got jealous :P
DivineCards 1 day ago 3

I dont mean to be a party crasher, but this idea was stolen from MysteryGuitarMan's marriage proposal a few months back. Sorry :/ /watch?v=lBx3-A3mLD8
naes9999 1 day ago

why are there 2377 dislikes! this video was awesome!

lilcgurl20 1 day ago

imagine if she said no.
H3cTiCRaDiATiOn 1 day ago 4

They are getting a lot of money from the clicks hahah as wedding present =p
rycebabii 1 day ago

I don't understand why this has gotten so many hits. I'm happy for the couple, but really this whole proposal saga is just absurd and over the top.
italianpride888 1 day ago

Nice to see theres still romance in this world

Fieldy1800 1 day ago 6

awwwww
sweetpari1 1 day ago

how do i get this free ipad -.-
KingLoganTremblay 1 day ago

awesome man......
Ironhide104 1 day ago

GO CANUCKS!!
SpaceStation49 1 day ago 13

This marriage is brought to you by

FORD BITCHES!
ZachAndVedder 1 day ago
This has been flagged as spam show
juvecanada 1 day ago

5:10 go RAMONES !

0554005192 1 day ago

Mystery Guitar Man did this like... quiiiite a while ago...
alexyuzwa 1 day ago

orrrrrr, it made me cry.....Congratulations
MrTommytucker56 1 day ago

AWESOMENESS

scarut 1 day ago

DUDE. I came to see JACKASS 3D I PAYED TO SEE JACKASS 3D AND IM GOING TO SEE JACKASS 3D WHERE THE FUCK IS IT!!!
SuperMicklovin 1 day ago

why so much hate? congrats to the both of you, I hope you are very happy in your lives together :)
PabbyBoy 1 day ago

Best marriage proposal ever! By far the sweetest thing I have ever seen!
13TaraDise13 1 day ago

That guy's getting pussy tonight
MegaShiny 1 day ago
This has been flagged as spam show
scarut 1 day ago

This is a porno? Under the views its says

As seen on Pajarracos- Porno, Humor, Noticias Curiosas y Webcams Amateur. LOL
N3wbyB3wby 1 day ago

@Shedde16

I don't think it was actually a real audience, I think he had told a bunch of friends of theirs that he was doing this and told them all to be at this theatre, it was dark inside so she didn't recognize any of them. That's my theory anyway, a bunch of them came down to give her a hug and such so I think that;s what happened
EruptionRules 1 day ago

LOL this is so copied from the mysteryguitarman proposal!
elitescooby 1 day ago

@elitescooby Who cares...
samuel7897 1 day ago

sabes si hay algun video subtitulado en español, gracias

02ddi 1 day ago in playlist Greatest Marriage Proposal EVER!!!

This video succeeded! It made 2,375 people jealous!
BumblebeeSwift 1 day ago

maravillosooooooooo !!!!!!!!!

chacotopher 1 day ago

wouldn't it be funny if she said no
bxxx9 1 day ago
This has been flagged as spam show
MyPoem4u 1 day ago
This has been flagged as spam show
TheMrFreshPrince1 1 day ago 2

AWW HOW CUTE !!! CONGRATS
lalakimmie19 1 day ago

that's sweet. but i bet the people who actully WANTED to watch the movie were like cool story bro. now turn on the movie!
priya2598 1 day ago

damn that was awesomely unexpeted how'd he find the time to do that
KingKazma105 1 day ago

did the people end up watcher the movie that they paid for?LOOOL
shedde16 1 day ago

thats so awesome :)
angelADuae 1 day ago
This has been flagged as spam show
Amanda2184han 1 day ago

Hey everybody, if you wanna watch something cool check out our video. Remember to give your rating. Thanks!
MyPoem4u 1 day ago

it make me cry....congratulations guys
athena128551 1 day ago

wowww 12 million
4lifecopt 1 day ago

I wish you the greatest life together.
Fankarlin 1 day ago
This has been flagged as spam show
TheyCallMeWendy 1 day ago

What if she said no....
TheReapersWay 1 day ago 4

@TheReapersWay Then they don't get married... Common sense bud
xSchneids 1 day ago

I LIKE IT. wonderful
thanhvanphongdinh 1 day ago
This has been flagged as spam show
ThaRealMsWayne 1 day ago

Very unique .. let's hope he's that enthused in 10 yrs lol.. my bf prop 2 me on hall.ark crd- - that was unique too! I still hv the crd n it's been 40 yrs..
mistylatteable 1 day ago

love this!!!!
wittchimp 1 day ago

i wonder what every body else was like
TheThenerdanotor12 1 day ago
This has been flagged as spam show
MyPoem4u 1 day ago

Mistery Guitar Man Proposal Idea!!!
gunacopter 1 day ago 3

I like it! It's so romantic!
kilunore 1 day ago

Thumbs up if you hate people who ask for thumbs up
FOODMONST3R 1 day ago

@FOODMONST3R SHUT. THE. FUCK. UP.
Branos93 1 day ago

Hey! Sit down im trying to watch the movie!
FOODMONST3R 1 day ago 4

It was very original but the rest of the people there must have been like: " seriously? Grats and all but I payed to see the movie not a family get together"
MariaChikitita 1 day ago

what if she's on a date with this other guy while the trailers goin
Shazzamnwithoutus 1 day ago

so touching

jamesbz19 1 day ago

haha, did some one shout get lost at 5:09
gmwphnehn 1 day ago

Congratulations! Perhaps I'm a sap but this was fantastic!

:huggles:
tarlah 1 day ago

I was overjoyed n cried... Awesone
vontan72 1 day ago

That guy in the back was like "WTF when does this movie start?"
O8adk 1 day ago

@O8adk u clearly didnt realize that the audience was everyone they knew ....

emotioNrgX 1 day ago

how rude to disrupt the movie that the rest of the audience paid to see...
OobydoobBanoubie 1 day ago
This has been flagged as spam show
MyPoem4u 1 day ago

After this he'll never know if she really loved him for him ...
HelloMyNameIsBob977 1 day ago

OKAY WHY ARE THERE THOSE FREE IPAD ADS EVERYWHERE??? I HATE FRIGGIN SPAMMMERS GET LOST.
ImHumgry 1 day ago

@TheBMXStreetlife fuck off troll get a life dickfaced lunatic
whitepeoplesuckass 1 day ago

Okay so how did he do that???

Suesbob 1 day ago

thats fuckin aWEOSME

bobtheforth 1 day ago

Omfg this was the cutest marriage proposal ever!!!

I started crying when the dad gave his daughter's hand in marriage to matt

I hope if i ever get married i can get a proposal as awesome as this :)
dxroxxx 1 day ago

@dxroxxx And let's hope you do something equally as awesome for the guy you're with. A lot of women out there have such ridiculously high expectations, and they fail to return the favor. If you don't get what you want, don't bitch about it, because most likely, you were the source of the problem.
realmofsilence 20 hours ago

Awwwww
ScottPilgrimXRamona 1 day ago

i wii do something like that, but with a new lady..never with my wife,,,hehe
1922eduardo 1 day ago

what was the movie
MizeryCinema 1 day ago

2372 people got rejected when proposing because their gf's "wanted it to be like matt and ginny"
CarnageMerc 1 day ago
This has been flagged as spam show
MyPoem4u 1 day ago

....That kinda made me cry...Haha xP I'm way to sentsitive!!!
AnimeFreakxDMuchx3 1 day ago

swag.
t1mTV 1 day ago

not bad... pretty original and well made...
TheLostProphecies 1 day ago

lol you can tell he has a lot of money..
tommy20464 1 day ago 2

@jakkes96w was the ipad thing real? can u message me the site if its legit ? =]
Poncho707 1 day ago

@Poncho707 Its not legit, its fags tryna get attention..
jordan5168 1 day ago

omg thats so cute!

BeautifulinSanityx13 1 day ago

cute <3

GrimmjowJaegerjaque0 1 day ago

wtf? so theres no movie
tuber52 1 day ago 2

So How am i supposed to One up This haha congrats man. My girlfriend is gunna hate me though if i cant come up with something almost as cute
kaysaps 1 day ago

@kaysaps Well, then she doesn't deserve you. A woman who is that greedy deserves nothing good in life.
realmofsilence 20 hours ago

How could there be ANY dislikes at all for something so sweet!!??

This isnt making the movies jealous, this is making ME jealous....
jordanpruittjuli 1 day ago

I was waiting for her to say no
chvick 1 day ago

Оригинально, красиво. Такое признание на всю жизнь запомниться. Лишь бы не кончался "запал"
LirisNSK 1 day ago

Oh my, that's adorable. Congrats on the yes.
ToBeAVampire101 1 day ago

it sucks for the guys who took their first date to that movie.... raising the bar man...
laughing31 1 day ago 6

well he kind of set the bar for marriage proposals pretty fricking high so it's going to be a challenge to beat that

BlazyNonVevo 1 day ago

LMAO 3:09 Great Proposal
Extreme105 1 day ago
This has been flagged as spam show
shreder89 1 day ago 6

@shreder89 he looked more like "say what! no movie dog?" xD
Made0fStone 1 day ago
This has been flagged as spam show
kulpreetg 1 day ago
This has been flagged as spam show
kulpreetg 1 day ago

WHAT IF SHE SAID NO?

HISTORY WILL BE MADE.

GO CANUCKS GO
Cherub217 1 day ago 5

/watch?v=c7G5m302AiM ....watch an AMAZING MW3 TRAILER (all rights go to infinity wards)
That1SpawnCamper 1 day ago

i bet this guy made alot of girls around the world hate their bf's for their types of proposals XD
Spdking7 1 day ago 2

Why didn't he run on the wall at 3:50

meh
RickyMossip 1 day ago

GO CANUCKS GO!
canucksftw7 1 day ago
Comment removed
3dpcman 1 day ago

This is... wow. :') made me cry.
bbyd0ll1 1 day ago

GO CANUCKS GO!!!
ravballer 1 day ago

IF YOU DISLIKED THIS YOUR A HATER!!!! this is beautiful
Olusmakingmoves 1 day ago

people who propose in front of crowds are lame
engela2 1 day ago

@engela2 I think it's adorable...:/

DarkGates8 1 day ago

@DarkGates8 what if she doesn't want to marry him? No pressure, right?
engela2 1 day ago

loved it, i reckon this has got to be the cutest and madest proposal everrrrr!! meannn!! <3
HAZBRO17 1 day ago

hahahah that black guy in the red shirt..."wtf i paid 12 bucks for this" hahaha

ps no offense to black ppl

NYGPiNoY 1 day ago

@NYGPiNoY lmao
tiBbLeX 1 day ago

this is HILARIOUS

/watch?v=htHOXVLhmcw

thumbs up so everyone can see

thanks for your support :)
kulpreetg 1 day ago
This has been flagged as spam show
kulpreetg 1 day ago
Comment removed
getsilly222 1 day ago

@getsilly222 ... more proof most woman are greedy roots!
tiBbLeX 1 day ago

@tiBbLeX true my friend, very true!
getsilly222 1 day ago

Way to raise the bar hommie :D
redboycaptures 1 day ago

Now every guy is going to have to do something like this.
xshonofthedeadx 1 day ago

The More Beautifull video for the moment

liltitan1000 1 day ago
This has been flagged as spam show
MyPoem4u 1 day ago

what was the music played when runs into the theatre with the popcorn in slow motion?
abeltherock 1 day ago

The black man in the background is best

FeelingLuckyPunk100 1 day ago

@mvaldezdz lol yes, yes i am being trolled lol
GDI109 1 day ago

@GDI109 no you're trolling.
mvaldezdz 1 day ago

@im123go Thank you very much ....have a nice day ; )
TheTheAnnashow 1 day ago
This has been flagged as spam show
MyPoem4u 1 day ago

Way to raise the bar....dick
shubadishwa212779 1 day ago 28

best thing I have ever seen.

ever.
GBassVlog 1 day ago

super cool dude!nxt tym Imma do this to my one and only girl! :) different move man, lol!imma not copy yours,., XD this is so perfect! :) nicely done,.,
alexisprinceM2 1 day ago

GO CANUCKS GO!!
MacManReviewer 1 day ago 4

Very nice i hope their marriage lasts for ever.
marthabirmaher 1 day ago

Presuming this is real....if he was going to go to this whole effort, he should have at least made the preview WAYYY better, pacing wise and such. Could have ended up much better with a little more thought.
clive2345 1 day ago

@clive2345 ARE YOU FUCKING KIDDING ME?!........
AlbertaSteeze 1 day ago

@AlbertaSteeze not in the slightest. The whole reveal was retarded, it had very little ummmppffffff to it.

But anyway, as stated by many. The whole video is most likely a total fake.
clive2345 20 hours ago
This has been flagged as spam show
MyPoem4u 1 day ago

gay!
mata168 1 day ago

this was pretty sweet
djkells3 1 day ago

Great job! That's true love.. Not many guys do what you did nowadays.. Congratulations!.. I'm still waiting for my bf's proposal.. haha..
xxelizabeth24xx 1 day ago

@xxelizabeth24xx Yeah, and not many girls are genuinely deserving of such treatment. You expect so much, but give so little in return. If you weren't so shallow and only went after a guy based on looks, then maybe you wouldn't be making such a ludicrous statement in the first place.
realmofsilence 20 hours ago

*le sigh*...what does it take to recieve a man like that who will put sooo much creativity in a marriage proposal....#lovedit
cebm07 1 day ago

everyone else in the theater is like "Yaay... Alright settle down... SHUT THE FUCK UP I WANT TO WATCH THE MOVIE"

thebsenior 1 day ago 7

Wow thats awesome! good job dude! (Y) =D
GeneralPanzershrek 1 day ago

the best!!!
keonmiss 1 day ago

stop talking in the theater bitch
SoccerDudeACW 1 day ago

That was epic!
xoxsupersxox 1 day ago

@wgamador

why would you resist? if you dont like it, why would you watch the ENTIRE video. this should make you want a girl. if you could get one.
rachelovesyoulots 1 day ago

@rachelovesyoulots

Yeah cause you know for sure that to the left of me is a woman laying down with nothing but her top.

Save it. You dont know me at all.
wgamador 1 day ago

COPYCAT!!!!!!!!!!!!!!!!!!!!!!!!! ALREADY BEEN DONE BACK IN 2009!!! Check out "My USC Movie Theater Engagement Proposal"
T0rche 1 day ago

this is amazing
cothman 1 day ago

Awwwh :) LOVE THIS !
Barbiiegirl123 1 day ago

what was the song called when he's running with the popcorn?
metalsnak6 1 day ago

@metalsnak6 it is called O Fortuna composed by Carl Orff
guidrynj 1 day ago

TUMBLR<33
SmileLee6 1 day ago

they probably fucked like savages that night
thomonkey22 1 day ago 4

Wow il s'en est donné du mal pour faire ça ! Félicitations !!!
juicyjuly22 1 day ago

This is a sweet marriage proposal, very well done, very similar to the one my husband did for me back in 2009 - check out "My USC Theater Engagement Proposal".
only1genevieve 1 day ago

@only1genevieve Just saw your husbands video. Looks like Matt stole his idea and got 12 million hits for it.
thaddeusvanderman 1 day ago

103,021 lonely women with their cats dream of a proposal like this

2,365 single men want to hurt Matt for screwing it up for the rest of us.
thaddeusvanderman 1 day ago 5
Comment removed
getsilly222 1 day ago

This is wonderful. There should be more love like this in the world. Well done ~ I hope your life is filled with much love and laughter. Just remember though, that the proposal or wedding is not what it is about, but the marriage that you spend your lives building. I think you are off to a fantastic start. Yahoo!!!
susanfryer932 1 day ago

the asshole stole my idea:p
HiroM2J 1 day ago 3

lol never expected him to add a Jagged Edge track to this vid.
dunkAmania002 1 day ago
This has been flagged as spam show
I2ogerlehot 1 day ago

what camera is this?
TECHLIFE20 1 day ago

@rosztun let me ask you this. do you think they give a shit that u didnt like this? do you think they are sitting behind their computer looking for pointers? did you make ANY difference by critiquing this video? keep ur dumbass opinion to urself. fuckin HATER. dont be mad that u have a small penis. and if ur a girl dont be mad that u would be lucky to have a proposal half as good as this one.
BV10707 1 day ago

@BV10707 You must be really really retarded, good luck living in your trailer.
rosztun 21 hours ago

longest trailer ever, now i want to see the divorce sequel
omegatestament 1 day ago 2

Fake or not.

Lame.

Marriage proposal like that are fucking corny. Agree or not, its the reality.
GuerreroBestEver 1 day ago

How hilarious would it have been if she said no.
GAYBLACKPEOPLE 1 day ago

you know this could be fake?
JustAnotherYtuber 1 day ago

@JustAnotherYtuber its not. we know the people. they live very close to us. this is the theatre i always go to. so no its not fake one bit
TECHLIFE20 1 day ago

de seguro lo vieron en taringa y por eso vinieron..............
FLYOATH 1 day ago

that was sweet, now if only all guys put that much effort into it.
ctakabahinah 1 day ago

@97Caylum really?

haniekunie 1 day ago

im not cyring....really

omgfgpaperclipx 1 day ago

AWESOME!
krazykap0 1 day ago

Profoundly stupid and clearly fake. The turn the lights OFF when they show the trailers and there is no way they got that clear of a shot without her knowing she was being taped. Oh and she just happens to not realize the theater is full of everyone she knows, WITH all the lights on?
mstenacious1 1 day ago

@mstenacious1 He did say i have another "surprise" for you and that was when her friends came down at the end and she was hugging them.. dont be jelous that was the best proposal anyone could have thought of
ilovecoke23 1 day ago
Comment removed
getsilly222 1 day ago

@ilovecoke23 I'm not the slightest bit jealous. I'd have said no and walked out if my husband did that to me. You're gullible if you think this is real. They just happen to have a website set up for the media to contact them? With a feed full of things like "Train just commented about us on Facebook!" or "Don't forget to follow us on Twitter!" This is fake, just like a bunch of other proposals gone viral in the past.
mstenacious1 1 day ago

@MaximusLupus THANk, this music score is so dramatic and good. =)
AkiraKeiKyo 1 day ago

@AkiraKeiKyo Most classical music relaxes the mind, this one prepares it.
MaximusLupus 1 day ago

2,362 men are making smart financial and life choices :)
getsilly222 1 day ago

whoooo..now time to make sum BABEZZZZZZZZ!!! =D
AdiTeachaG 1 day ago

i hate thumbs UP comments . thumbs DOWN if you agree!!
wighty44 1 day ago

That gave me chills lol, Beautiful just beautiful
music1jr 1 day ago 3

what a great proposal uncle matt
jnerize 1 day ago

2370 people were rejected XD
Rodmx90 1 day ago
Comment removed
Rodmx90 1 day ago

it would be funny if she said no
nickmaila 1 day ago 5

High five for first kiss

2011-07-15T01:58:00.000+08:00

Do you remember how you felt when you had your first kiss? This was captured by accident, in its most innocent form. If only it could be this way every time... Meet Elliott and Bowie.

they are NOT related. She is literally the "girl next door". Love is her middle name. His shirt is a coincidence

Beautiful Words: The Power of Words

2011-07-01T17:19:00.002+08:00

This short film illustrates the power of words to radically change your message and your effect upon the world.

Comments:

It's not about words, the new sign is no more elegant in turns of sentence than the old one. It's about how we think, or how to communicate. The first sign appeals to our want or need to help another fellow who needs help. We give money to ease his pain. The second one places us in the shoes of the blind man, we give more money to ease OUR pain. Which brings out a interesting point, we tend to value our own pain more than we value the pain of others.

It took a few minutes before it hit me.. But it was very touching nonetheless..

This video's message is that I should pity the blind because they can't see what I see. Do you really think the blind can't experience the beauty in the world? It's not true that blind people can't "see" a beautiful day! They just "see" it differently from the sighted. I agree with the importance of using the right words, but not with the message of this video. Give blind people educations tailored to their needs, and productive jobs, and they won't need to beg for change on the streets.

This video has to be one of the most wonderful videos I have seen on YouTube

I reacted with tears. Why, because those who are less fortunate are all around us every day and we do not notice until there is just the slightest bit of difference. I did not cry because he was blind, I cried because of our ignorance and lack of care for those in need unless something catches our attention that is our of the ordinary.

Cute Kids Pictures in Video

2011-06-26T00:32:00.002+08:00

Cute kids' pictures.

Kids are really cute!

Cute babies chatting

2011-06-10T01:34:00.001+08:00

How adorable!

What do you think these babies are talking about?

High five for first kiss

2011-06-01T01:57:00.001+08:00

babysitter bullmastiff akino

2011-05-23T19:01:00.000+08:00

.... a child and his dog... a love story without any word.

Most Inspirational Video - Hug for the World

2011-05-15T11:22:00.002+08:00

This is one one of the most inspirational videos ever. It features music by Enigma and is titled "Hug for the World"

"Dude we are all the same, we are one race, humans. Unlike the animals where they got tons of different types of breeds and kinds we are all in one, unfortunately man itself separates and distinguished everything it sees"

"I need a hug! OOO well good thing I have a pitbull, when i need a hug he's always there & never asks why he just accepts it & is happy to get it."

Cute baby alternate hands

2011-05-07T02:25:00.001+08:00

This cute baby is quite persistent.

You are beautiful

2011-05-01T00:15:00.002+08:00

You are beautiful

It's on the wall to remind you that you are beautiful

Beautiful Dad - Playable Angry Birds birthday cake

2011-04-23T02:47:00.002+08:00

"It's become a family tradition that I make increasingly ridiculous birthday cakes for my kids each year. So with my little boy Ben turning 6-years-old over the weekend, and appreciating his love of Angry Birds, I thought I'd have a shot a making him a playable Angry Birds birthday cake with working catapult and iced birds as ammunition."

What a beautiful father!

When someone hurts you

2011-04-14T18:37:00.002+08:00

When someone hurts you . . . .
Don’t feel bad because its the law of nature
that the tree that bears the sweetest fruits
gets maximum number of stones

Enigma - Return to Innocence

2011-04-10T02:07:00.000+08:00

One soul touching, amazing beautiful Enigma song full of emotions and a genuine sense of nostalgia for one's childhood .

Lyrics :
That's not the beginning of the end
That's the return to yourself
The return to innocence

Love, devotion
Feeling, emotion
Love, devotion
Feeling, emotion

Don't be afraid to be weak
Don't be too proud to be strong
Just look into your heart, my friend
That will be the return to yourself
The return to innocence

If you want, then start to laugh
If you must, then start to cry
Be yourself, don't hide
Just believe in destiny
Don't care what people say
Just follow your own way
Don't give up and use the chance
To return to innocence

That's not the beginning of the end
That's the return to yourself
The return to innocence

Don't care what people say
Follow just your own way
Don't give up, don't give up
To return, to return to innocence

If you want, then laugh
If you must, then cry
Be yourself, don't hide
Just believe in destiny

You are beautiful

2011-04-01T00:12:00.003+08:00

You are beautiful

The stickers describe you

Earth Hour 2011

2011-03-25T21:52:00.003+08:00

Do support Earth Hour 2011 tomorrow (26 March 2011) by switching off your lights for an hour. Do visit the official website at http://www.earthhour.org to check the time of the event for your location.

This one hour of energy-saving period may be very significant but by getting everyone to join in, this project will create an awareness to help to make our Earth more beautiful.

We will appreciate it if you can spread the message.

Beautiful Proposal

2011-03-25T15:34:00.002+08:00

An amazingly orchestrated wedding proposal in Madison Square Park. After the surprise production number in the park for this girl, they rode off in a horse drawn carriage. In the dance the slip of paper the guys are waving around is a poloroid. The song the guys dance to was "their song"

This Is Why Many People Don't Eat Meat: "From Farm To Fridge"

2011-03-20T12:39:00.000+08:00

Please treat these animals better.

It is a fact that not everyone can turn into vegetarian, however, we can try to eat less meat.

Most of all, please use a less cruel way to kill these animals.

Make everyone's life beautiful - think of animals too.

If you can’t …

2011-03-14T18:35:00.000+08:00

If You can’t Fly !
“Run”
If You can’t Run !
“Walk”
If You Can’t Walk !
“Crawl”
But Keep Moving Towards Your Goal!

Cute baby video

2011-03-06T18:44:00.000+08:00

Babies are our past and future.

As described by the owner, the baby girl farted and scared herself.

The dog farts and scares the cat away

2011-03-05T11:28:00.002+08:00

This is a cute video of a cat being frightened off by a dog when he farts.

Hope this can brighten up your day!

You are beautiful

2011-03-01T00:09:00.002+08:00

You are beautiful

Hope you get to know it

What do people live for? 人为什么要活着？

2011-02-27T20:31:00.002+08:00

Why do people live for?

5 elderly and dying Taiwanese found purpose to live...

What is your dream and purpose for living today?

This is a very inspiring video in Chinese mandarin. The director did an excellent job

Live for your dream.

Never ever forget your parents

2011-02-22T18:15:00.001+08:00

* When I’m old, and not myself anymore.
o Please understand me, give me a little more patience.

* When I spill my soup on my shirt, and I forgotten how to tie my shoelaces,
o Please remember how I first taught you to do everything with my hands.

* When I keep repeating and nagging you over and over again,
o Please be patient and listen to me, don’t interrupt me.
o When you’re young, I had to keep repeating thousands hundreds of time to mould you to who you are.

* When I require you to bath me,
o Please don’t find me irritating.
o Do remember how I find all means and methods just to bath you.

* When new technologies and stuff I don’t understand,
o Please don’t laugh at me.
o Think of how I replied to so many of your (Why..)s when you’re young.

* When my legs are tired and unable to walk,
o Please lend me your young strength to hold me.
o Just like how I hold you when you started your first step in life.

* When I suddenly forgot our conversation topic,
o Please give me some time to think.
o Actually to me, the topic is not important, all I want is to have you by my side to listen and I’ll be satisfied.

* When you see me getting older, please don’t be sad.
o Understand me, encourage me, just like how I treated you when you started to learn everything in life.

Hard Times Are Like a Washing Machine

2011-02-17T18:33:00.000+08:00

Hard Times Are Like a Washing Machine,
They Twist,
Turn & Knock Us Around,
But In The End we Come Out
Cleaner, Brighter & Better Than Before…

You are beautiful

2011-02-01T00:05:00.002+08:00

You are beautiful

The signs are up for you

Chris Medina - Break Even : American Idol 10 Auditions

2011-01-31T16:37:00.001+08:00

It's a nice voice, and sad but beautiful story.

Do You Realize - by The Flaming Lips

2011-01-30T03:01:00.001+08:00

Do You Realize
that you have the most beautiful face
Do You Realize
we're floating in space
Do You Realize
that happiness makes you cry
Do You Realize
that everyone you know someday will die

And instead of saying all of your goodbyes, let them know
You realize that life goes fast
It's hard to make the good things last
You realize the sun doesn't go down
It's just an illusion caused by the world spinning 'round

This is my wish for you

2011-01-21T02:27:00.000+08:00

This is my wish for you:

comfort on difficult days,
smiles when sadness intrudes,
rainbows to follow the clouds,
laughter to kiss your lips,
sunsets to warm your heart,
hugs when spirits sag,
beauty for your eyes to see,
friendships to brighten your being,
faith so that you can believe,
confidence for when you doubt,
courage to know yourself,
patience to accept the truth,
love to complete your life.

Do or Die

2011-01-14T18:30:00.000+08:00

Old concept:
“Do or Die”

New concept:
“Do b4 u die”

Latest concept:
“Don’t die, until u do”

The Starfish Story

2011-01-06T11:10:00.000+08:00

This is an inspirational video for teachers. It is a very old story about saving lives.

There are too many people for us to help and we know we cannot save everyone. However, do as much as you can just like the saying "save a life is a life".

You are beautiful

2011-01-01T00:03:00.004+08:00

You are beautiful

The sea water can remove the beautiful carving on the sand
but it can never rinse off your beauty

Please drive safe - a heart touching video

2010-12-25T21:11:00.002+08:00

Life is too beautiful for you to make a mistake out of your recklessness.

Keep safe. Drive safely.

Cute Dog Commercial

2010-12-20T01:51:00.001+08:00

This is something for you to cheer you up.

Very cute dog and actor!!!

Difference between hard work & luck

2010-12-14T18:28:00.000+08:00

Hard-work is like stairs
and luck is like lift.
Sometimes lift may fail
but stairs will always take you to the top.
Have a successful life ..!

Cat Adopts Rabbit

2010-12-10T00:42:00.000+08:00

A video about a cat adopting a teeny-weeny baby rabbit.

10 Most Important Things

2010-12-05T13:08:00.002+08:00

Love
The Special Feeling that makes you feel all Warm and Wonderful

Respect
Treating others as well as you'd like to be treated

Appreciation
To be Grateful for all the Good Things Life has to offer

Happiness
The Full Enjoyment of each moment with a Smiling Face

Forgiveness
The Ability to let Things be without Anger

Sharing
The Joy of giving without Thought of Receiving

Honesty
The Quality of always telling the Truth

Integrity
The purity of doing what's Right no matter what.

Compassion
The Essence of Feeling another's Pain, while Easing their Hurt

You are beautiful

2010-12-01T00:01:00.001+08:00

You are beautiful

Even the road sign says so

Love Language: Jubilee Project Short Film & Fundraiser

2010-11-27T18:02:00.003+08:00

Love - beyond words can describe.

No mushy words, no hypocrisy.

With sincerity.

Love rules over disabilities.

The Essence of Courage

2010-11-25T02:45:00.000+08:00

What does courage have to do with being a person of good character, with someone who stays true to their principles and their values ?? The answer is EVERYTHING.

You see, being values-driven means two things. Doing what's right, following our conscience, refusing to compromise our principles, despite pressures and temptations to the contrary and...Taking a stand against what's wrong, speaking out, whenever we see others do things that are incorrect or inappropriate. Unquestionably, both of those require guts and fortitude, they require courage.

Courage is following your conscience instead of following the crowd. Refusing to take part in hurtful or disrespectful behaviors. Sacrificing personal gain for the benefit of others. Speaking your mind even though others don't agree.

Taking complete responsibility for your actions and your mistakes. Following the rules and insisting that others do the same. Challenging the status quo in search of better ways. Doing what you know is right, regardless of the risks and potential consequences.

Make us to choose the harder right instead of the easier wrong and never to be content with a half truth when the whole truth can be won. Endow us with the courage that is born of loyalty to all that is noble and worthy, that scorns to compromise with vice and injustice and knows no fear when truth and right are in jeopardy.... That is truly the essence of courage..

Don't Give Up

2010-11-20T02:59:00.001+08:00

A pigeon can still hop with a leg.

Watch out!

2010-11-14T18:15:00.001+08:00

Watch your Thoughts, they become Words!
Watch your Words, they become Actions!
Watch your Actions, they become Habits!
Watch your Habits, they become Character!
Watch your CHARACTER!, It becomes your DESTINY!!

Cute Cat and Puppy

2010-11-07T16:42:00.000+08:00

Very cute cat and puppy!

The cat is busy eating while the puppy keeps disturbing him/her and bites the ears.

Calendar Planner 2011 for the Beautiful People

2010-11-06T18:18:00.003+08:00

Free Calendar Planner 2011 for all the beautiful people.

Hope you can use it wisely and plan well for your year 2011 better.

Support free services/products; spread the love.

http://smarttuition.sg/printable-singapore-calendar-planner-2011.php

Life is beautiful because of all the beautiful people.

Love Rocks - Sweet Commercial

2010-11-02T20:05:00.002+08:00

For you and your love one.

A very sweet jewelery commercial.

Beautiful life.

You are beautiful

2010-11-01T00:59:00.002+08:00

You are beautiful

I paste the sticker on my phone to see your beautiful when you are away

Choose your Color

2010-10-25T00:56:00.002+08:00

So you've got a problem?

That's good.

Why ?

Because repeated victories over your problems are the rungs on your ladder to success. With each victory you grow in wisdom, stature and experience. You become a bigger, better, more successful person each time you meet a problem and tackle and conquer it with a positive mental attitude.

Attitude is the mind's paintbrush, it can color a situation gloomy or gray or cheerful, in fact, attitudes are more important than facts.

If you don't like something, change it, if you can't change it, change your attitude, don’t complain.

Our attitudes control our lives. Attitudes are a secret power working twenty-four hours a day, for good or bad it is of paramount importance that we know how to harness and control this great force.

Ability is what you're capable of doing. Motivation determines what you do. Attitude determines how well you do it.

Our success or our failure is the result of our mental condition, our thoughts about people and about ourselves, our attitudes toward people and toward ourselves.

Your living is determined not so much by what life brings to you as by the attitude you bring to life, not so much by what happens to you as by the way your mind looks at what happens. Circumstances and situations do color life, but you have been given the mind to choose what the color shall be.

Twin Rabbit

2010-10-22T00:21:00.001+08:00

Cute bunny video - Twin Rabbit

It’s not important where u r TODAY

2010-10-18T18:13:00.001+08:00

Every King was once a crying baby and every great building was once a map.
It’s not important where u r TODAY, BUT where you will reach TOMORROW is important.

Meaningful Words

2010-10-13T01:19:00.000+08:00

1.Sometimes we underestimate the good things we have, chasing after the mirages of false treasures. We often see people letting go of their children, their families, their spouses, their friends, their profession, their knowledge....accumulated over many years. Their good health, the good things in life. Don't throw out so freely, things which were nourished with so much care and effort.

2.Look around, appreciate what you have, your home, your loved ones, friends on whom you can really count, the knowledge you have gained, your good health and all the beautiful things in life, they are truly your most precious treasures. We can no longer shower kindness on those we loved, after their passing....

3.It is useless to want to re-do the work that we may have done negligently. It's best to appreciate and do things well now. Don't let your problems and concerns degenerate into feelings of sadness and anxiety. Provide yourself with the courage needed to be certain of victory in the struggle of life.

4.We are all imperfect. Always praise and value your family, do all you can to make it even better. Always praise and value your co-workers, see what you can do to improve your environment. Instead of isolating yourself, because of weakness or failure, seek to invest in true and constructive friendship in your life. Strengthen your self-esteem in dealing with daily problems.

5 Important Lessons of a Pencil

2010-10-10T01:46:00.001+08:00

A pencil maker told the pencil 5 important lessons just before putting it in the box:

1. Everything you do will always leave a mark.
2. You can always correct the mistakes you make.
3. What is important is what is inside of you.
4. In life, you will undergo painful sharpening, which will only make you better.
5. To be the best pencil, you must allow yourself to be held and guided by the hand that holds you.

MARRIAGE

2010-10-05T00:36:00.001+08:00

When I got home that night as my wife served dinner, I held her hand and said, I've got something to tell you. She sat down and ate quietly. Again I observed the hurt in her eyes.

Suddenly I didn't know how to open my mouth. But I had to let her know what I was thinking. I want a divorce. I raised the topic calmly.

She didn't seem to be annoyed by my words, instead she asked me softly, why?

I avoided her question. This made her angry. She threw away the chopsticks and shouted at me, you are not a man! That night, we didn't talk to each other. She was weeping. I knew she wanted to find out what had happened to our marriage. But I could hardly give her a satisfactory answer; she had lost my heart to Jane. I didn't love her anymore. I just pitied her!

With a deep sense of guilt, I drafted a divorce agreement which stated that she could own our house, our car, and 30% stake of my company.

She glanced at it and then tore it into pieces. The woman who had spent ten years of her life with me had become a stranger. I felt sorry for her wasted time, resources and energy but I could not take back what I had said for I loved Jane so dearly. Finally she cried loudly in front of me, which was what I had expected to see. To me her cry was actually a kind of release. The idea of divorce which had obsessed me for several weeks seemed to be firmer and clearer now.

The next day, I came back home very late and found her writing something at the table. I didn't have supper but went straight to sleep and fell asleep very fast because I was tired after an eventful day with Jane.

When I woke up, she was still there at the table writing. I just did not care so I turned over and was asleep again.

In the morning she presented her divorce conditions: she didn't want anything from me, but needed a month's notice before the divorce. She requested that in that one month we both struggle to live as normal a life as possible. Her reasons were simple: our son had his exams in a month's time and she didn't want to disrupt him with our broken marriage.

This was agreeable to me. But she had something more, she asked me to recall how I had carried her into out bridal room on our wedding day.

She requested that every day for the month's duration I carry her out of our bedroom to the front door ever morning. I thought she was going crazy. Just to make our last days together bearable I accepted her odd request.

I told Jane about my wife's divorce conditions. . She laughed loudly and thought it was absurd. No matter what tricks she applies, she has to face the divorce, she said scornfully.

My wife and I hadn't had any body contact since my divorce intention was explicitly expressed. So when I carried her out on the first day, we both appeared clumsy. Our son clapped behind us, daddy is holding mommy in his arms. His words brought me a sense of pain. From the bedroom to the sitting room, then to the door, I walked over ten meters with her in my arms. She closed her eyes and said softly; don't tell our son about the divorce. I nodded, feeling somewhat upset. I put her down outside
the door. She went to wait for the bus to work. I drove alone to the office.

On the second day, both of us acted much more easily. She leaned on my chest. I could smell the fragrance of her blouse. I realized that I hadn't looked at this woman carefully for a long time. I realized she was not young any more. There were fine wrinkles on her face, her hair was graying! Our marriage had taken its toll on her. For a minute I wondered what I had done to her.

On the fourth day, when I lifted her up, I felt a sense of intimacy returning. This was the woman who had given ten years of her life to me.

On the fifth and sixth day, I realized that our sense of intimacy was growing again. I didn't tell Jane about this. It became easier to carry her as the month slipped by. Perhaps the everyday workout made me stronger.

She was choosing what to wear one morning. She tried on quite a few dresses but could not find a suitable one. Then she sighed, all my dresses have grown bigger. I suddenly realized that she had grown so thin, that was the reason why I could carry her more easily.

Suddenly it hit me... she had buried so much pain and bitterness in her heart. Subconsciously I reached out and touched her head.

Our son came in at the moment and said, Dad, it's time to carry mom out. To him, seeing his father carrying his mother out had become an essential part of his life. My wife gestured to our son to come closer and hugged him tightly. I turned my face away because I was afraid I might change my mind at this last minute. I then held her in my arms, walking from the bedroom, through the sitting room, to the hallway. Her hand surrounded my neck softly and naturally. I held her body tightly; it was just like our wedding day.

But her much lighter weight made me sad. On the last day, when I held her in my arms I could hardly move a step. Our son had gone to school. I held her tightly and said, I hadn't noticed that our life lacked intimacy.

I drove to office.... jumped out of the car swiftly without locking the door. I was afraid any delay would make me change my mind...I walked upstairs. Jane opened the door and I said to her, Sorry, Jane, I do not want the divorce anymore.

She looked at me, astonished, and then touched my forehead. Do you have a fever? She said. I moved her hand off my head. Sorry, Jane, I said, I won't divorce. My marriage life was boring probably because she and I didn't value the details of our lives, not because we didn't love each other anymore. Now I realize that since I carried her into my home on our wedding day I am supposed to hold her until death do us apart.

Jane seemed to suddenly wake up. She gave me a loud slap and then slammed the door and burst into tears. I walked downstairs and drove away.

At the floral shop on the way, I ordered a bouquet of flowers for my wife. The salesgirl asked me what to write on the card. I smiled and wrote, I'll carry you out every morning until death do us apart.

That evening I arrived home, flowers in my hands, a smile on my face, I run up stairs, only to find my wife in the bed - dead.

My wife had been fighting CANCER for months and I was so busy with Jane to even notice. She knew that she would die soon and she wanted to save me from the whatever negative reaction from our son, in case we push thru with the divorce.-- At least, in the eyes of our son--- I'm a loving husband....

The small details of your lives are what really matter in a relationship. It is not the mansion, the car, property, the money in the bank. These create an environment conducive for happiness but cannot give happiness in themselves. So find time to be your spouse's friend and do those little things for each other that build intimacy. Do have a real happy marriage!

World Habitat Day - 4th October

2010-10-02T02:30:00.003+08:00

The United Nations has designated the first Monday of October as World Habitat Day, a call to people around the world to join together to exchange ideas and advocate for the need and importance of housing. The United Nations’ chosen theme for 2010 for events in the host city of Shanghai, China and the rest of the world is “Better City, Better Life.”

(Walk through with a community leader at an Informal settlement in Santo Domingo. Images of the housing situation and the poor sanitary conditions.)

For more information about World Habitat Day, you may visit http://worldhabitatdaynews.org or http://www.habitat.org.

You are beautiful

2010-10-01T00:56:00.002+08:00

You are beautiful

I write it down on my palm and whisper it to you

Halo the Pool Playing Dog

2010-09-25T01:57:00.003+08:00

One of the most beautiful things on earth is dog. Dogs are known to be loyal and can be trained to do tricks.

One example is to play pool.

The touching Taiwanese commercial

2010-09-20T16:58:00.003+08:00

The daughter narrates about how ever since she was little, her dad always picked her up from school on his bike. She remembers the ice cream from the shop they always passed by.

After she left for school in Taipei, everytime she came home, he still insisted on picking her up in his bike. She finally bought a car, and told him to not pick her up. But he still waited for her with his bike.

In the end she says: "I guess he was worried that I would forget the way home..."

The love of her father is too great. Parents always treat their children as children, no matter how old they are.

Cute baby - Shi Shi

2010-09-15T19:55:00.002+08:00

They bring happiness to our world.

23 Years Old with Kid's Voice

2010-09-12T01:32:00.000+08:00

朱洁, 袖珍人来自内蒙古
23岁1米28

Zhu Jie, at the age of 23, is from Mongolia, standing at 1.28 metres in height.

She attended the talent search show in China and impressed everyone with her sweet child-like voice.

The best thing about her is that she's very optimistic and we have to learn from her in order to stay happy.

Sorry, the video is in Chinese Mandarin. Nevertheless, let her voice touch your heart.

Aim high in life

2010-09-10T18:12:00.000+08:00

Do not make your aim like the garden
because everyone walk on it
But make your aim like
the sky so everyone
wish to touch it.

Hachiko (Hachi): A Dog's Tale

2010-09-05T02:42:00.002+08:00

Starring Richard Gere and Joan Allen, 'Hachi: A Dogs Tale' is the heartwarming true story about an unbreakable bond between a University professor and his dog.

Hachiko, the legendary Japanese akita, proves that there is nothing more loyal than man's best friend in this modern retelling of a cherished true story. It all begins when a college professor adopts an abandoned dog named Hachiko. The two form such a strong bond that Hachiko walks with the professor to the train station each morning and returns to the station each evening to walk the professor home again. The routine continues until one day the professor does not return to the train station. Hachiko, however, does not give up. He returns to the same train station at the same time, faithfully waiting for his owner to return. Hachiko does this for more than nine years, until his own death. This heartwarming tale that is already the stuff of legend in Japan is finally making its way to America by way of prominent director Lasse Hallström. With an equally capable cast, the experience of Hachiko's unending loyalty is certain to stay with you. Hachiko's story is one of love, unwavering devotion, and the resounding impact one dogs affection can make.

Through his daily journeys to the station Hachi becomes a regular fixture of the community and an inspiration of love, friendship and unyielding loyalty to everyone who meets him. Hachi's story is a tale for the ages; a dogs faithful devotion to his master exposes the great power of love and how this simplest of acts can become the grandest gesture of all.

Charity: water September Campaign 2010: Clean Water for the Bayaka

2010-09-02T19:25:00.002+08:00

Charity: water September Campaign 2010: Clean Water for the Bayaka

Visit charitywater.org/september to see how birthdays can change the world.

There are a billion people living without clean water. Four Septembers ago, we had a crazy idea. We asked our friends to give up their birthdays and ask for donations instead of gifts. We used 100% of the money raised to build water projects. Every year, it got bigger. We've now helped over a million people get clean water. This September, join us again. Watch the Trailer. Visit charitywater.org/september. Start a campaign. Give up your birthday. It can change the world.

You are beautiful

2010-09-01T00:54:00.003+08:00

You are beautiful

I stack up the reasons why you are beautiful and I realise I'm short of cards to write on.

Cat gives a cardiac massage to his injured girlfriend

2010-08-30T00:27:00.001+08:00

This stray cat was filmed in Turkey( Kızılsaray district of Antalya ) trying to reanimate his female friend who got hit by a car. Even though some people tried to help him, the white cat wouldn't let them come near for two straight hours. Finally a vet arrived and took the injured cat. Sadly, it was too late and he couldn't resuscitate the feline.

Even in the animals' world, there is so much true love. Shall we show them better examples?

Why am I different from others?

2010-08-25T07:27:00.003+08:00

Extraordinary Pantene television commercial made in Thailand. It's simply brilliant. The story is about a deaf and mute girl who learns to play the violin against all odds. It's one of the most touching advertisements ever.

Question: Why am I different from others?
Reply: Why do you have to be the same like others?

No matter what happens, life can be beautiful if you persist.

Touching Cancer Commercial

2010-08-22T00:50:00.002+08:00

Before her brother's return, the little girl went in search for a scissor and cut her own hair. This short video clip is definitely able to keep you in a suspend for the start. When her brother returns in bald head because he is a cancer patient, the little girl offers her hair to her brother.

The little boy may be in a sorry state and feeling the pain, but he is fortunate to have such a loving sister who is willing to sacrifice herself.

What were we born for?

2010-08-20T02:40:00.000+08:00

The touching story of a pregnant lady asking the doctor to operate on her so that she can conceive her child earlier to allow her dying husband to see and feel the happiness of their newborn.

Words from Bill Gates

2010-08-18T05:05:00.002+08:00

Bill Gates gave a speech at a High School about 11 things they did not and will not learn in school. He talks about how feel-good, politically correct teachings created a generation of kids with no concept of reality and how this concept set them up for failure in the real world.

Some words may be harsh, but he sure hits the nail on the head.

Rule 1: Life is not fair - get used to it!

Rule 2: The world won't care about your self-esteem. The world will expect you to accomplish something BEFORE you feel good about yourself.

Rule 3: You will NOT make $60,000 a year right out of high school. You won't be a vice-president with a car phone until you earn both.

Rule 4: If you think your teacher is tough, wait till you get a boss.

Rule 5: Flipping burgers is not beneath your dignity. Your Grandparents had a different word for burger flipping: they called it opportunity.

Rule 6: If you mess up, it's not your parents' fault, so don't whine about your mistakes, learn from them.

Rule 7: Before you were born, your parents weren't as boring as they are now. They got that way from paying your bills, cleaning your clothes and listening to you talk about how cool you thought you were. So before you save the rain forest from the parasites of your parent's generation, try delousing the closet in your own room.

Rule 8: Your school may have done away with winners and losers, but life HAS NOT. In some schools, they have abolished failing grades and they'll give you as MANY TIMES as you want to get the right answer. This doesn't bear the slightest resemblance to ANYTHING in real life.

Rule 9: Life is not divided into semesters. You don't get summers off and very few employers are interested in helping you FIND YOURSELF. Do that on your own time.

Rule 10: Television is NOT real life. In real life people actually have to leave the coffee shop and go to jobs.

Rule 11: Be nice to nerds. Chances are you'll end up working for one.

To us, we see a beautiful meaning behind all the rules, which is to APPRECIATE. Appreciate whatever you have now and you will find your life more beautiful.

Cute Dog Who Knows How to Apologise

2010-08-12T13:56:00.013+08:00

Language: Japanese
Subtitle: Chinese

This cute dog knows how to apologise to his owner after making the owner angry.

- Kneel down
- Tear
- Bow

CUTE!

Do not worry about failure

2010-08-10T18:10:00.000+08:00

Do not worry about failure…
Worry about all the chances
you miss when you don’t try.

'I want more time'

2010-08-07T03:08:00.003+08:00

This is a sad commercial.

I want more time...

Time to tell my son that I love him more than anything.
Time to understand him better.
Listen to his opinions.
To talk to him.
Listen to his songs.
To tell him I'm sorry.
Like I said.
I want more time.
Time to do what I've never done.
To take better care of him.
To love him more.

Will you love me if i get fatter

2010-08-05T02:11:00.017+08:00

A very beautiful animation done by a student for the final year project.

The little girl went chasing the bad guy for her prince but she was cursed by a spell and started growing big tummy. In the end, she managed to save her prince, but the prince ran away from her because of her looks.

The graphic is beautifully done up and the simple story is humorous.

Will you love me if I get fatter?

The question is - will you stay with your other half regardless of all circumstances?

You are beautiful

2010-08-01T00:49:00.003+08:00

You are beautiful

Your beauty is more lasting than steel and more charming than the sunset

A Girl's Hope (English) by MCYS

2010-07-29T02:20:00.004+08:00

In the latest Family TVC by MCYS, nine-year-old Adelyn captures our hearts as she aspires to feel the hopes and dreams of the Youth Olympic Games athletes. Join her in A Girl's Hope to "Live Our Dreams".

There's a hope in everyone, have you found yours?

Time is like the water of a river

2010-07-24T18:09:00.000+08:00

Time is like the water of a river.
You can’t touch the same water twice.
Because the flow that has passed
will never pass again.
So,
Enjoy every moment of life.

Missing Someone..

2010-07-18T04:48:00.000+08:00

Soldiers giving surprise to their loved ones

Lyrics for the background song..

The Mile After - Money Is Not A Thing

This won't be easy,
but I have to try.
I'll have to leave in dead winter
and come back in July.
I'll have to sing what I feel
almost every night;
but if this does anything,
and it will, you'll see,
I'm gonna do everything
to put you next to me.

This is keeping me up
so I decided to just give in;
call it a night...
I've run out of different ways
to tell you what I've tried
a million other times.
I doubt that I could leave you
and I still doubt you'd even care;
but how could I lead my life
and always say truth,
but never dare?

I can feel the undertow;
Will it drown me? I dont know...
Don't you see it's you I need
or will you leave me lost at sea?
You'll miss the salt and offshore breeze
and I forgot to mention, me.
I don't think that you should go
I can't stand to be alone...

Some very Good and Very bad things ..

2010-07-15T05:02:00.002+08:00

The most destructive habit.....................Worry
The greatest Joy......... ......................Giving
The greatest loss..................Loss of self-respect

The most satisfying work.................Helping others
The ugliest personality trait..............Selfishness
The most endangered species........Dedicated leaders
Our greatest natural resource..................Our youth

The greatest 'shot in the arm'........ .Encouragement
The greatest problem to overcome...............Fear
The most effective sleeping pill.......Peace of mind
The most crippling failure disease...... .......Excuses

The most powerful force in life................... Love
The most dangerous act.......A gossip
The world's most incredible computer.......The brain
The worst thing to be without................... Hope

The deadliest weapon...... ........ .........The tongue
The two most power-filled words....... .... 'I Can'
The greatest asset....... .......... ......... ...........Faith
The most worthless emotion..................Self- pity

The most beautiful attire........................SMILE!
The most prized possession...............Integrity
The most powerful channel of communication. ..Prayer
The most contagious spirit................Enthusiasm

Life ends; when you stop Dreaming,
Hope ends; when you stop Believing,
Love ends; when you stop Caring,
And Friendship ends; when you stop Sharing...!!!

Touching Health Screening Commercial

2010-07-12T00:52:00.002+08:00

Singapore Health Promotion Board commercial to advise people to go for screening.

A very short video of a father sending his son, who is reluctant to leave him, to school. When his son turns back, he hides behind the building. His son looks very sad without him.

The commercial is telling us that if we don't go for health screen regularly, we may end up disappearing from our beloved ones' lives anytime.

Filial Piety: Father and Son (Eng subtitles)

2010-07-03T20:55:00.000+08:00

Follow the journey of a young boy, as he sees first hand the importance of respecting, honouring, and loving his parents, through the best and the worst of times. The latest installment of National Family Council's Family campaign, Filial Piety: Father & Son revolves around the ups and downs of a three-generation household, with the heart and soul of the campaign captured by the line, "How one generation loves, the next generation learns."

Love - Katie Kirkapatrick and Nick's Wedding

2010-07-01T01:31:00.005+08:00

The girl in the picture is Katie Kirkpatrick, she is 21. Next to her, her fiancé, Nick, 23. The picture was taken shortly before their wedding ceremony, held on January 11, 2005 in the US. Katie has terminal cancer and spend hours a day receiving medication. In the picture, Nick is waiting for her on one of the many sessions of chemo to end.

In spite of all the pain, organ failures, and morphine shots, Katie is going along with her wedding and took care of every detail. The dress had to be adjusted a few times due to her constant weight loss

An unusual accessory at the party was the oxygen tube that Katie used throughout the ceremony and reception as well. The other couple in the picture are Nick's parents. Excited to see their son marrying his high school sweetheart.

Katie, in her wheelchair with the oxygen tube, listening to a song from her husband and friends

At the reception, katie had to take a few rests. The pain did not allow her to stand for long periods

Katie died five days after her wedding day. Watching a woman so ill and weak getting married and with a smile on her face makes us think..... Happiness is reachable, no matter how long it lasts .

We should stop making our lives complicated.

Life is short
Break the rules
forgive quickly
kiss passionately, love truly
laugh constantly
And never stop smiling
no matter how strange life is
Life is not always the party we expected to be
but as long as we are here, we should smile and be grateful

You are beautiful

2010-07-01T00:45:00.002+08:00

You are beautiful

I wish you come by the building everyday because you make everything beautiful

Happiness is...

2010-06-24T13:11:00.000+08:00

Happiness is a journey, not a destination.

Funeral - English

2010-06-19T22:58:00.004+08:00

"Funeral" is a new TV commerical launched by the Ministry of Community Development, Youth and Sports (MCYS) which looks at relationships in a different light, through a woman at her husband's funeral. Ultimately, the TVC celebrates the beautiful imperfections that make a relationship perfect. This is fresh off MCYS latest Viewers' Choice 2008 win for the Family TVC which promotes the importance and value of family bonding.

This is a very cool video.

The Burnt Biscuit

2010-06-15T11:44:00.002+08:00

Mom liked to make breakfast food for dinner every now and then. And I remember one night in particular when she had made breakfast after a long, hard day at work. That evening, mom placed a plate of eggs, sausage and extremely burned biscuits in front of dad. I remember waiting to see if anyone noticed.

All dad did was reach for his biscuit, smiled at mom and asked me how my day was at school. I don't remember what I told him that night, but I do remember watching him smear butter and jelly on that biscuit and ate every bite.

When I got up from the table, I remember hearing mom apologize to dad for burning the biscuits. And I'll never forget what he said: Honey, I love burned biscuits.
Later that night, I went to kiss Daddy good night and asked him if he really liked his biscuits burned. He wrapped me in his arms and said, "Your Momma put in a hard day at work today and she's real tired. And besides - a little burnt biscuit never hurt anyone!"

You know, life is full of imperfect things.....and imperfect people. I'm not the best at hardly anything, and I forget birthdays and anniversaries just like everyone else.

What I've learned over the years is that learning to accept each others' faults - and choosing to celebrate each others differences - is one of the most important keys to creating a healthy, growing, and lasting relationship.

Because in the end, you are the master of your own life - to be happy or unhappy, to be positive or negative.

We could extend this to any relationship. In fact, understanding is the base of any relationship, be it a husband-wife or parent-child or friendship.

Don't put the key to your happiness in someone else's pocket - keep it in your own.
So please pass me a biscuit, and yes, the burnt one will do just fine ...

Balance sheet of life

2010-06-11T04:59:00.003+08:00

Our Birth is our Opening Balance!
Our Death is our Closing Balance!
Our Prejudiced Views are our Liabilities
Our Creative Ideas are our Assets

Heart is our Current Asset
Soul is our Fixed Asset
Brain is our Fixed Deposit
Thinking is our Current Account

Achievements are our Capital
Character & Morals, our Stock-in-Trade
Friends are our General Reserves
Values & Behaviour are our Goodwill

Patience is our Interest Earned
Love is our Dividend
Children are our Bonus Issues
Education is Brands / Patents

Knowledge is our Investment
Experience is our Premium Account
The Aim is to Tally the Balance Sheet Accurately.
The Goal is to get the Best Presented Accounts Award.